Description :
From Genome Similarity Track
Location :
Scaffold_4:1215910- 1217045
Transcript NameFunction/comments
Phyin_T30-4PITG_03258ATP-binding Cassette (ABC) Superfamily

Sequence
1135 bases(100 bases per row)
TCCTCATTCTCCGATTTACAGGCATCCGCTCAAGTCACCAGCTAAACTTTTACAAATCTTTTTGCCATGAAGCTATTTGCACAACTTGCCACTGCCTGTT
ATGCGCTGCTTGCGTCCACTAGTCTCGCCGTTCAGGAAGAGACCAAGACCCTCGACGAGCTCTATGCCGACGCCATCGCCGAAGGAGGCAACCTCGTCTT
ATACCACGGCGGGGACTTCTCGTCGCAGCAAGACGCGTTGCATGATGCCTTCATCAAGGTCTTCCCGAAAATCAAATTCACGCTTATTGTCGACTACAGC
AAGTACCACAACGTACGCATCGACAACCAGCTCGAAAACGACAAGCTGGTGCCTGATATTGTGGCGTTGCAGACACTGCAGGACTTCCCTCGCTCGGCAC
AAGAGGGCAAGCTGCTGGAATACAAGCCCGCCAACTTCTCGCAAATCTACGATGGCTTCCGGGACCAACGTGGCGCCTACATGGCCTACATGATGTTCAC
CTTCAGCTTCCTGTACGACGAAACTTCGCTGGGTGGTCTCGCAGCGCCCAAGTCACCCGCTGACCTCGTGGATCCGCAGTGGGGCGGCAAGATCGCCTCG
ACCTACCCTAACGACGACGATGCCGTACTCTTCCTGTACGCACGTTATGTGGAGAAGTACGGCTGGAATTGGGTCGAGGACTTCGCCAACCAGAATGTCA
CGTTCCGCCGCGGTTCCAATACGGCCAGCGATCTCGTTACGGCCAAGGACAAAGTCATCGGTGTCGGCACTTACTCGCAGGGTACACCCAACGTCACGTT
TGTTACGGACGGCGGCAACGAATATCTGGCATGGGGTCAGGGCATCGCCATCTTGAGTAAGGCCAAGTACCCAGCAGCCGCAAAGCTCTTCATGAACTGG
GCCATCTCGGAGGAGGTGCAGAAGACAATCCTGCCCGAGAACGTTCGTGTGGACCTGACACCAAACAGCGGTTCAAGCCACCCCTGGGAGATTCGCCAGG
CTAATGTGGATGAGTTCCCAAAGTTCATGGCGGACCGTGCGAGTGTGGAGCAGTGGCACCAGACATTTTCACTGTACTTCGGTGAAGTGAAGGGTGAGCA
AACTCCTGGTTTCCTTGGCCTGTATCCGGGCCTAT