Description :
From Genome Similarity Track
Location :
Scaffold_200:121583- 126893
Sequence
5310 bases(100 bases per row)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCCACCGGGCCCAAGTTG
AAGATCAAGGATGGGGGATCCAAGGTACTACGGGAACATGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGCTAC
GTGTCAGACGCAGATGAGCTTGCAGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATTGCCAAA
AGCCTCCGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATTAGGATTCGACGGTTCGGACTCCGACCCAGA
GGATTACCGTCGAGTCTGTCTCACTGCATCTAACGATCGAACGGCGAAGACCGGAGACAACTCGCGATCGGGGGATACCGTACCCGGGGACCGTGGGATG
TACAGATCCCGAGATATCATAGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATATGGATGCTGGAAACATCTGGTCC
ATGATAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGTGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGA
ATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTACCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTT
TGAATCCGGTACGAGCCGAGCGTTCTAGATATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGTCCCTAGATCCAGTCGATAA
TACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTCGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAA
AGGGGAGAGGCACGTGGTTATTGGGAGAAACGCCATCATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCATCTAAGGTCTATCAGG
TCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAG
ACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAG
GTTGGGTGCCAAGTGGATGGGAGTCGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACAAATGGGAGAACGCGGATCAGGATCACGCTGGC
AGGATGTTTGGTATACTGGTTCGATATTTGGGTTGAAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCTGGAGTGAGGTTG
GATCTGGCGGATGGGACACTGTGTTTCCCGGACGAGATGCTGATCCAGCTCAGTGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATAAGGGCAG
ATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAGCTGCCAGATCGGTTAAAGTGGGTGGAACATGAGAAACGGTGGGTCACCCGGGGCGAGAAGTG
GGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACTAACGTCAGCGACAAGAGACTACTACTGGACCATTATGAGGAGATCGGG
CGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGAATCCCGTCGCTACAGAGAATGACAGAATTTGGCGTACGAGGCAACTA
CCGAGATTGAATCTCGCGGAGAAGGGGAGCCCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGCTCCTACAGAG
GGATCGTCGGATTGAGATCCAAGCGGTTGAGGTTGGATCCAAGACCGGGGATGATCCCCAGAGCCGGTCTCTAGATAACCCAGGGTCGGTGGACGGAGGA
TCGCAGAGAGCGGAAGCCGGGTCGCCAGATCCTGCTAACCCACAAGTGGATCCTAGCTTTTCATGGGACAAAGTGCCTGGATCCTTGTCGAGAGTGGCGA
CGCTAGTCAAACAAGAACCGTCGCATTTAAACTCGCTAGATGATCAAGTCGATCAAACAAGTGACTTCCCCGGTACCAGGGTACTTGATCCTACGAAGAC
AGAAGGACGACGGTTGAAAGAGGGTCGCGGTGCTCGGATCCAATGTTGGATCCGACGAAGACTGAAGATGAACAAGTCTGTTACCATGAAGTCGGGGATC
TACACGCCGAGGATCTCGGTGAAGGCATGGCGGTGATCCCGAAGGTACCACTGACCACAGAGGAGGTCACGATTGACGACATCCAAGTGGATCCAGGGGC
GAACGAACCCGCGGAAGTGAATCGGTTACGTCAGAAGATCTGGGAAAGCTGACATCTGCTGATTGGTAAAGGTAATGCATTATCGCCCGCTGCCCGCGGA
GTCAAATGTAACATCGATGTCGACGACGCAAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGG
GCCTCCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCAT
TGATTACCGGCTAGTTAACGGCCTGCCTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTAAATAAAGTACTCTGGTACTGT
TCTCTTGACATGGCCAGTGGTTTCTGGGTGGTGACTATGACGGATCGAGCTCGCGCGATATCCACATTCATCACACCGTTTGGACTGTTCGAGTGGAACC
GGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAGCGCCTGATCGATAACGCCCTCTACGGATTTACCCGCATACCGGAACCCGAAAGGGGTGG
ATCCGGGGAAGGTCATACGGAAGTGGATCCATTCGAAGCAGAAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGAC
ATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTTTCTATCAGTGTGGTAAAGA
GCTATTGGGG