Description :
From Genome Similarity Track
Location :
Scaffold_799:12158- 14704
Transcript NameFunction/comments
g16487.t1hypothetical protein

Sequence
2546 bases(100 bases per row)
CAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGG
AGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTACCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCACAGCACGAACGTCGGCATAATCTGAA
CGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACTGAAGAGCGCAGAACAGAGAGCAAC
ACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGACCGAGGA
AGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGCTCGACGTGGAGAAGGCGTTGGCAAACCAACGACGATTATTGACGTATGCCTAA
CGTCCAGGGTCCAAGACGTTGTGAATGGGCGCCATCGGTCTTCCTCCACACCACTGTTTGTGGAACATTGGCGCTTGAAGTGGCCTGGCGAATTCAAAAT
GACGTTGTCCTGAAACAAGGTTCGTCTTCACCCCCTTTACTGGCTGCACCCCAGATTGTTGGGCAACTGTACGGATCGCAGCGTTCGACAACACATACGA
GCGTGATAACCAAGCTTTTGCGTTCACGTCCCATTGGCGCTTCGTAGCTCCAACCGATCGCTTCCGGAGGTCAACCTAGGCTGCAAGCGTAGGCGGACAT
CGAGGGGCGTGTAACACGTACCGCATCCAGGGGTGCAATGGGTCACTACTTGGGATGTCTACTCCCCTATATTGATCCGCACCGGACAGCGCAGCGGACC
CTAATTCGCGCAGATCTATATGGGACGGACATAGCAGCAGCCGCGCGCCAACGCCGCAGAGGAAATTTTTGGCTGACGTTGATCCTGTGCGTTGATGGAC
ATATGAGCAAATGATGGAGCAGCAAACCATTTGCTCAGGCATTCTGAGTTTTCGCAGGCAATGGGCTCCGGAGACACGAGCGACGTCGTGGAATATGGTG
TTCCGCCTGCCACACGAAAATATAGCGCATCCTCGAGCATACAATTTTGCCGAAACCGTTTCCTGAGTAGGCGCGAACGCCTCACGAGGACGGCAACCTG
GATAGCCCTCGCGATCAATACTACTGGTATTACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCGCTTCAGTACCCTCTT
CTGCTTCCATATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCG
CCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCA
GGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGTGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTTAACGAAGGTACAATTCAGCTG
GAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTTAGCCAAG
TGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAA
GCCTGATGTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCTGATCAACAAAACGCTCAGGACCGCCCCGATATT
GTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTC
AAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCT
TCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGGAAACCCGTCATGCGCTTGCATGAAG
GACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAG
GCGTCCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACAT
CAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGT
GCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCT