Description :
From Genome Similarity Track
Location :
Scaffold_24:1215705- 1219237
Sequence
3532 bases(100 bases per row)
GTGACGATGACAATCTGTTCGACGGGGCTCTCGCGTCTCCCCGAACGAGAGGGAGGATTACCTCTCTGCTCGAGACTCCCAGAGGTCGGGCTCAGTTTCA
AGATCACTTGCTGCAGCTCGCCAGTCAACCTGCTCCTAGTGAACTGACCGGCGCAGCGTCCCACCCGCGAGCAGAACCTACGGTTCGGTTGCTGCCCAGG
AAGTCGACGGGGCGTGGCGCTCACATTTGACCCAGCCCGCCCGTCCTTGGGACCTGTTGAAGGAGAAGGGAGGAACGTGACGGCTGCCGCGGGTCTGCAA
GGACCAGGATTGGAAGGGAGCGAGGAGGAACGCTCCAGGGACGCAAGGACCGCGGCCCCAGCTAACGTCTCGACTGGAGGAGCGAGGAAGGACCCCTACT
CGGTCCACCGTGACATCGACTGTTGGAAGTGGAACGCGAGACACAGACTCGACCTTCCAAGCGCTCTTAATCGACTCCTTCCAACAAGCGCTCCGTGGCC
TCTCGCTGAACGATGCGTCGGGAGGATTGCGCCAAGCACGAGCTCCGCCCTCGTCAATGGAAGACCGCCGGAGCCTAGAGGCCGCGAACCCAAGGATGAC
TCCGGGAACGGTAGCTGCGACTCCGACAGGGATGCCGATGGCGGCGATCCCTTCGTATGGAGGCGTTTCATTCCAAACGCCTCAGCCTGGCTGGAGCAGT
CGAGGGGCAGGATCGCCTCTGCCCGGGGCGTTCTACTCTCCTTTTCAACCTCCTGTGACGCCTACGTCTGGATGGAGCGCCCATGGGACGCGACCCGCCT
GGACCTCGGCACCGGTAGCCTCGGAGGCTCCAACGTCTGCTACCTGGGAGGCGGGTGGGCGACATGCCACCACTGGCGGGGAGTTTCGCGGGAACGCTGG
TACTAGAGTACCGAGCTACGACGACAGACAGAGTGGGAGGAACCCGACGAGCTCAGGGCTGCCTTACGAGCCGATGGCCTACCCTATCGGTGGCCAGGAT
GGCCGATATGGAACGGCAACGGTCGGAAACTGTTCGTATCGGAACGCCCCTAACATTGGGATTCCCACCGAGTTAAGGAACGCCGTAAAGGTCATCGTTC
CTTTTTACTCTGACACGGCCACGAGCGAGAGAGCCGCCGCTTTTTGGCGTTCCTACGAGAAGTGCACCTACGGCATGGACGACCAGATGAGATTAACGGC
CTTCGAGCAATGCCTGAAAGGCAAAGTGGACCAGGAATGGTGGTACAACTCGAGAATCGATAGCTTTGAGACGTTAAGGGTGTGCTTTCACAACCGCTTT
ATCCGTCAGACTTCGACGCAGCTCTGGAAGAGACTCAAGGTCGCTAAGAGAAACCGCGGCGAGTCGGCTGAAGAATGGGGCGACCGCATTATGACGATAT
GCGAAGCTCTAAACTACCCCGAGCCCCGCATGCAATTCGAGTTCTTCATGGACGGGTTGCGCAACACGCAGATGAGAGCAGTCCTGAATGGTAGTATGGT
AGCGTCCATTCCGGAAGCGTGTGCGCTACTGCTGTACAAGAATCAGCACTTGCCTGTCGAAGAAGAGGACGAGTTCGCCGAAGAGGGAACGGAGTCAACG
AGTGCCACCGCTCAGGCGTCTACTCACTCGCAAGTGCTTCAGCAACTGCAATTGATGAGCCAGATCATGTTGAACAACCAACAGGGCTCTGGAACGCAGC
TTGGACACATTAACGTCGTGGCTCCGAGTGTCCCTCAAGCGCCACAGGCTTCCAGCGTCCCAGCTTCAAACGGGAACGCTAGTCTTGGACCGCTGAATAT
CCGACAGGGACCGGACACGCGAACGACTGAAGGCGAGATCGTATGCGGTCGTTGCGAGCGAAAGGTTTGTAGTAGGGAGAACTGTCCGCGAGGCAAAGGA
CGCTGTAATCGCTGCCAGCGAGACGGACATTATTCGATGGAGTGTAACTGGCCCAAGCCAGCTAGCAATACTCGGAATGGAGGGCGTCGTGGACTAGAGT
GCTTCTTCTGCATGCAAAAGGGACACTCGATGTCGAATTGCCCAGAACTGGCACAACTTCGTAGTCTGGCGGGAAACGCTAGCTCGACGAGAGCAGCCAC
TCCCACCGGAACGTCCCAGCAATGAAGGGGGCAAGAGGGAGGGAAAGAAAGTGTCGCTCCTTCCTCTTGCCTAGTTGGCGACACACAGAGGGCTGAAGGT
TCATAGGAAGTGAAGATTGCGGTGGAACCTAAGAGGGCTCTCGGGAGTAGCAAGGAGACTAGTGAACGCGCTCGGAGCGCTCTCACTGCGAGTGTGACAG
TTGGAAGTGAACAGGAAAACGTGGGTAGCTCGAGGAACGAGCAGGGACAAGGGAGCGAGAGCACGGATGGAGCAACGGAACGCTCCACCGTGACGCTAAT
CGGTAGTGTGGAGGCAACGGAACGCTGTACTTTGTCGAAGGGGAAAGTCGACGGAACTACGACGCAGTCCAGAGGGACCCCAGGCGTCAGGGAGACGAAA
AAGGTATGCTTCGCTGAAGCAGAGGAAGCCACGGAGGATATCAGAACGATAGAGGAGGCAACGGTGCTAACAGCTCTACGATGTACAAGGGTGCTATCGA
GTCGAATGTGGATGAGGCTGCTAGCATCAAGGCACGCCAAGCTGTGGCTGCCGTGGGAATTGGGAACGATGAGGACAAGGTGACGGTAGCGGGAAAAGAA
GAGAAAGAAGGACATAGCGAAATAATAAATTCTGCTAGTCGCTATGACCGTTTGCTCTCTGACAAGGAGCTGGATATGCTCGAACTCGGTGAAGACTCGG
GCGTGAAAAGTGATTTCGAAGAATATGCGAAAGAACTGGAAGATCGTTTGTTCCCGCTGGACGACGAGAGGATACTAGAGCGTGCCAAGCGGAACGCTGC
TGGACTAGGAAAGCCGACTCTGGCGGATATGAGCGTGACACTTGGAATACCGGAAGCTGTCTTGGAACGCACACGGGCCGTCTCAACTGGGGATATGGGG
ATGCCAGAGTACTGGCCGAATTGGTATGCCGACGCGTTAGAGAAGTCGACGGTAGCGAAGCGTGCCAATCGAGACTTCAAGGAGGTGCAAGCAAGGGGCT
CGCAACTTCCGACGGTCAACGTGGTCGCTGTAAGCGAGGGCAAGTGCGATGAGACTGCAGAGCCGGACAGGATGGTAGAACAATAGTTCGAAAGGAACGT
GTGCGTCAGACTGGACGAAGCGACCATCCCGGTATCTCGAGACTGTGAAGACAGTGGCGGGACGCTGCCGTCTCGATGGCGTGCAGGGGCTCGAAGGTTG
GTGTACGAACTCGTGAAGCAGGATTGGGATGCAAAGAGAAGTCTCCCTTCGAAGACAACGGAGCCTCCGAGAGAGAGAGGTGGCGAGGGCGAGGATGACC
CTCGACGTGACGCCGCGACTGGAAACGTCCTGGACGAAGGGGCGCTCCGTGGCCACCTCTGTAAAGTTGGGGGAACGCTAAGCGAAGCGTTCCTAAATTG
TGCAATAGTCTGGGCTAGAAGTTATTTTGAGG