Description :
From Genome Similarity Track
Location :
Scaffold_505:12156- 13406
Sequence
1250 bases(100 bases per row)
AACTCGCCGTCGGTATCGCACAAAGCGGTCGCCAAGCCCAACCGACAGCGATCAAACCACACGAGCTCGGCGATGGCGCCATCGGTGTATCACAAAACCT
GGGGAAAATGGGTCAATGGCCGAGCTGTGGTCGAACAGATCAGCTGTCTCCAACTCGAAGAGCAGGTTTTGGCCAACCCCCAGAACGAAGCAACGCTAGT
TAAACTGTCGTTACGATACGCGCGCTGGTCGGGAACGAGCCTAGCTGCGATACTATTGCTCGAGCATGCGTCTTCGCTGCACGAAAACGCTCCGCGCAAT
CACGAGTTCTGGAACTCGATGGGAAACGCACACCTGGACATCTTTCTGCGGCATCACAAGTTCCTTCCTGTTGCTCGGTTCCACTTGGCTCGGTGTGTGA
ACTCGTTTACAAGGGCACTCGCGTTTATGGAGAGCATGGCCGACCCGCTCCTGCTTCTTCGTTTTGCACTGTGCCAGTTCTGGATCGTGGAAGAGGGCCA
TCTGGAGAAGGCGAATGACATTTTGCACGAGCTGCTCCAGAACTTCGCCAATTTCTGCGATCGAGACCGAGTCAACCTGCTATTTTTCCATTTCCAGATC
TTGCATCGCCTCAAAATGTATGCCGAAGCGGTTGAGAATATCGACAAGATCATTACTATTGTATCGCAATCGACTGGAGCAGGTGCGACAACACAGGCCG
CTGCAGCTACCGGCGATGCACGCGGTGCGAGTTCGGCGTCGTATGAACTGTCGGACTATCGAATGATGTTGATGCAGACGCTCCAGGCGAGCGGAGATTA
TGTGCAGGCCTCGTCCATCTTTTCGTTAGTGCTGAGCGGCAAGAATATGCCCCAGAACGGATGTTTAACTGATGAGCAGTATTTCGAGCTATGGCACAGT
ATTGCGGAGAAGTGCTTCTACCACGAAGACTACGCTCTTGCTGGCGAGTACTATCCGATTGCGCTCAACTTTGCGAAGGAGTCGCACGTGCTGGCGACTG
TCCATCACAAGATCGGCCTGTGCTTCCAGGCACTGGGAGAGAATGAACGGTGTGTGACGGAGTTCAAGCGAGCGCGGAACTTGAACCGCCATATCCGTCC
TCCCGTTTCGTTGTTTGATCTGCACGGAAGCTTCGACGATCAATTCGCACTGTTACTTGAAAAGCCAGTGCGTCTGATCATCGAAGAAGTGCGGCTCAAC
CTGTACGATCGAGCTGTGCGACAACTGCAGCTCGTTTTCCGCCGGAAACA