Description :
From Genome Similarity Track
Location :
contig_9:121550- 123793
Transcript NameFunction/comments
g2597.t1ETI37048.1 hypothetical protein F443_16943, partial [Phytophthora parasitica P1569

Sequence
2243 bases(100 bases per row)
TAGACTCGAGTGCAGGACTACTTGACGCGGGATACAAACTTGTACTGGCTCAGCTGTCGGAGGGAGCCCTTCTGCACCATAGCTCGAATCGCGCGTTGAA
TAGCGTTGGGGTTGTAGCCCTGCGCCTCGAGGCGGCTGTACAGTGCACTGGTCTCGACGCGGGTACCAATACGCAGCGTGCGATTGATACTCTGCTCCAC
CTCCTGCGCTTTTTCGTGGAAGCCGCCAAACAGTCCCTGGGTGCCGTCGTCCTTGGCAGCGTTCATCGTACTCACGCTGAACAATCGGATCGCCTCCTGA
ACGTGGTCGCGCGTGGCCTCGTTAAGCAAGTGCATCTTCGCCAGCGATTCCGAAATACGCACGAGGGCTTCGAGCTGTCGGACAGTGACAGGAATCGTGG
TCTCACCGCCCTGTGTACGACGCACGTCGTCACGCACACCAACGTAAAAGTCCTGAAGCGCCTGCGCAGCTCCAACCGACAGCCTCGGTGCGCAGCGAGT
ACGGCAGTACGTGATAAATTTCTTGAGCAGCCACGGCTCGAATTCACCGCCGCTGGAGGAGTTTTCGCTGGCCAAAGATTTGCCAGCAGCCGACGCCAAA
GCGTTTGTGTGCATCCGCACGACGTGTGCAGCCATTTGTCTGTCTCGAGCGTCATCCTGGATATCACGCACGATGAAGATCATGTCGAAACGACTCAGAA
TCGTACTCATGAGGTCAATATTCTCCGAAGCCGAGCGCATGTCGTCGTAGCGACCGAACACGGGGTTGGCAGCGGCCAGCACACTGGCGCGTGAGTTGAG
AATCGTGGTGATACCAGCCTTGGCAATGGAAATGGTCTGCTGCTCCATGGCTTCGTGAATAGCGACACGGTCCGACTCGCGCATCTTGTCAAACTCGTCA
ATGCACACTACTCCACCGTCAGCCAGCACCATGGCGCCTCCTTCCAGATAGAACTCGCCCTTGGAGTCGCGAATCACAGACGCCGTCAGACCTGCTGCAC
TGCTACCTTTACCCGACGTGTACACGCCAACGGGGGCGATTTTCTCCGTAAACTTGAGGAACTGCGACTTGGCCGTACTTGGGTCTCCCAGCAGCAGTAC
GTTAATGTCACCTCGCAAGATCATCCCGTCCGGCAATCGCTTCCTCGATCCTCCAACCAACAAACACGCAATGGCCTTCTTCATATTCACCGTATAGTCA
CCATAAATCGACGGCGCAATGCTGGCCGCCAATTTCGGGTACAGGTTCGGATCTCGTGCCATCTCGTGGAATTTCTCCTCTTCCGCAGGGGAGAACGTGG
CTTTCGCGCGTCCAGCGCCTTCCTCGTCGATCTCAATGCCTACCACCCGCAAATACAGCGTGCGAATAGCCACAGCGCCGACGTTTTTGCCCCCCGCATT
CACGACGGATGTAATGCCCACGACTGACACTCGCGTCCCGGGGGACGCTCTGTCCACCAAGTGGCGGTCCGCAATCAGCGCCAGATTCCGAGGCATTTCG
CCCGTGGGCACCACCTCCGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCCACGTACTCGCCCCTGTCGGGCAGTACAATGTACGAGTCCTTAGGACAAG
CGTCTCCCGGAGCTACGCCATTGTCCTCCTCCCGCATGCGGTCACAAATGCGGGGGATGCTCACGCCGCCCATCCCCGAGACTGCAACACGCTTGACGTG
TCCGCAATTGCGGCAACGTAACGTCGCGGACACGCACTTGGTCCTGACACGAGTGGCACTGATGACGATGCCAGGCACTTTCACCAGTCGATTAATCTCC
TGCGCGTGCACGTGACGAAGTGCGACAGGCGCCTGGTCACTAGTCAGAATGGCCTGGATGTCCGGCAAGTTGGCGGAATGGTTCTCAGATGCGGTCAAAG
TAGCTTCTTGGTTGCCGTTGCCGGTGACGAGCAGCTGTGCCAACATTTCCTTGGCCGCGTTCTCCAGCAGAGGTAGCTGCTCCTTCGGGCTCTTGAGCAA
AAGGTCTTGCAGCTCCTGGTCGAAAGCCGCTACGTGTGACACGTTCACCGTCACGAACCAGTGTTTGCGCCGCGCGTTGGCCAGAAGTTGCTCGCGGTAG
TAAAACAGCGGGCCCACACGGAACCCGCGCAGGAAGGCCAGCAGGCGGCGCTGCAACGCGGCAGGACTCGCGCCCTGACGATCGTCTGACGCCTGCGCGC
TCTCCATGCCCACGGCCGACACGCGACCCGCATCCCAGTCCAT