Description :
From Genome Similarity Track
Location :
Scaffold_18:121543- 125701
Transcript NameFunction/comments
Phyca_LT15347245structural maintenance of chromosomes protein 5 puta

Sequence
4158 bases(100 bases per row)
tgcagctacttggacgagctgacaaagttggacagttcgtccgtcacgagaaggaaagcggctacacggagatcgagttgttcttcgaacgaggcaacaa
agtaattagacgcaatattttcagggacaacaagagcacgtggcaagttaatggcaaggactcgactctgaaaaatgtggctggaatcatggaagccgcc
agcatccagatcgacaatttgtgccagttcttaccgcaggataaagtaggcgagttctctcgtatgaaccccgtccagctgctcaaagccacagaaaacg
caatcacggatagtgacttggcagccaagcacgacgagattgttgagttgcagcacagtatgtcagacaaaggacgggtaggctgcagattgaacgggaa
atagattgatccggtactgatagaggaatttgtggtggtgcaggaactggagcatgcccgtgcagcgttggagttaaagaagagtgaaaacgcgcagaga
cagaaagaggtggagcgtattgaggactacgaagcgcgcattgaagaggtgcgtactggtagtttgtgtgtgcgttggaaactaagatgaagactgaact
ggttatggtatttgcagacgtcagtgatggagaaaaagtgtttgtggctcgagtttgagcaagcgaaagtcgaagtggaagaactgaaggaagagaagat
ccgttgcaagcaagccatcacggtgcgtattaattattgtgcctaatatttcctctgaaggcactgataattttgcgtataatgctggttgtagaatgaa
cgcaaagaaaagatcgatcctctcgtagagctactaaatgatgagcagaacaagctggagaacgtcaagactgagtacgtggaggtagtaacgtgaccaa
tggtgcgccgattttgctaaccgggggttgtgtaaatatttaggaaagcagaggtggacaacgaaaagcgccagcttatcgaaagaattagacatgagaa
aaagaacgtaagtgaagccctcaattcggtgcttttatggaaaacattgccatgtctgactttgatcctctgtttacaattcagattgagtccatggaaa
atgcccaaaaccaaactttgtcggatgtcaaggagttacgcaatcagcacaactctacccgtcgaaaactcgaacgtttggagcgcgatgtggaagacgt
tagtcctagtatttgctttttcattgactatatgactgattgttgcacaatttggtgatgcagtggaaaaaagagcgtgaggggatggccgatgacacta
agctcaaagagcaaaaggagaagttggaaagggagcagcgtgccaaggatatggaggtaaagtgcatgcactagctgagtgaatatttatgacaatattt
taacattttattgcccggataggaaaccgaaattcggagtaagcgagaagctcttgctcgtgaactatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtgagcagaggaaggtgaaacttaagctcgag
aaactcgataacgaggatgtccagcggcgattagctcttcagagatttgatcccgactcaatccgcgctgcagaatgggccaaaaacaaccaccaccggc
tgaagcggaaagtatggggccccgttgctctggaggtatgtttgtttgccacttcattcaaccttacggatacttactgacaccacatttctctacccac
agatgaagcttaacgaaataactcatgcgaagtatgttgaagacactcttccaaaatgggtcctaggagcgttagtgacagagtgctacgatgattacaa
cacaattctccgcgagatcaataacgggtccgaccgccgactgaagatctcgattgtaaacgtggaaggcggggtatgtcgcgatattcatcgaccatac
tcagatgagaagatgagggagtaccgcgatagatatggcatggtggggttcctggatgaggtaagtgcattcgagtttttgttcaaactacaacgaaagt
gattgtttatttaacgctgtcatgattggttgttgtcgttctgcagctggtaactgcaccggatattatccacgaagctcttcgcacccaggctggcctg
cacaccgtcatggtcggctctcagaaaacagaagatattatcaacagaggcgggcaaatttttcaagagatcgcatcggctgaacgaaaaactgcgtttg
tgaccccatacaagaaatacgtcacatcaggtatgagttcccaataacgattcaggtattttgcacacgttaacttgggttttgattgtgcacagtgtcc
aagtatggaaaccgaaatgtgactacgcgtacaaacgacctcatgaaccctcgtttgctggcgacctccacttctaatgaagacgagaaagctgatatga
caaagatcttggatgagctggtatcaagggagagaaggatccaagacgaagtaaagcattgatttttagcctcactctggccatgcgtgatgactgacca
ttgaatttcgtgcactttcagattaccgacctcaaagggcaagagagagagtacgctgaggagaaaagaaacgctcagcatcgcatcactgagattcgtt
ctcagcggaaggcaattattcgtttggacgataagattcgcgagggtgccaacaagatttactcactgcagagtgagctagcacaggtgagtacactttt
ctagttgctatgccatcgattttatgcttactgtttctctgtttaggatgtgtcggcaaaggaggagtcgttaactcgaaaattgaagaaccaagcctca
aagtaagtagttgtgtgtcatgtattggcacgtgtgcttgcttacatgctaatactgttggtgcacactatcaggcaagcgcagcagatccaacgttgtc
tacaaatgtcaagagatctgttcaaggtcagcgctcaggaggcatgcttatctctgcaactcggaacacaacaagttcgagtcgatttcatacacaagca
cctgaaacaaatggatgccaccctgcggtaagtgctgtcctattctatcgtcctgttattcataagctgacacaattatgtaacagggaactgaaggagg
cttacaagctggctaaggataacttgctagccgtagcgaagaaggcaatggacctgaaacgcaaggcagaagaagaagccccatgggaaacttacgaaga
gcgtttcaacgaacttccagatgacttggatgagctgcttggcaaaattgaaaacaataaggcagctcttgaatgcttccgtggcgatagaagcattcgt
gaactttacgagcgtgtgcgcgctgagattgaggacgatgaagcgcacctggcagacctggatagttttgttacccatggtgaagacaagatcaacggca
tcaaggtatgatctcttggatggattcttggagcttctacacgatacttacccaattctttgatgctcaaatttcatggttcgatttgcagggaaaatgg
cacgccgaccttaaagaagtggtggagcacatcgatacctcttttagaaagttctttcaggatatcgggtgtgttggcgagatcttgctggatgacgagg
acccggtaagttgtttctgagcgattataaagctacagaaatgtatttaacgatgtgaatgtgcgcgttttaaatgtttaggacgtatcaaagtggggca
ttcagcgccgggcacagttccgtaagaacacgaagctatctacaatgacagctgaggaacaatccggaggggtacgtttaatatctggatgctgctgaat
gaaacagcactcaattaactggttacgctgaatgcaggaaaaatctgtgggaacaatcatgtatttgatggctctccaaagcctcaccaagtgcccattc
cgtgtggtggacgagatcaaccagggtatggatgtgtacaacgaacggaaggtgttccagcggatcaccaagtcctcgtgtggtagcaaattgccgcagt
acttcctcatcactccaaaactcattactggacttacgtatcaccgggacacaaaggt