Description :
From Genome Similarity Track
Location :
contig_9:121537- 123780
Transcript NameFunction/comments
g2752.t1hypothetical protein

Sequence
2243 bases(100 bases per row)
TAGACTCGAGTGCAGGACTACTTGACGCGGGATACAAACTTGTACTGGCTCAGCTGTCGGAGGGAGCCCTTCTGCACCATAGCTCGAATCGCGCGTTGAA
TAGCGTTGGGGTTGTAGCCCTGCGCCTCGAGGCGGCTGTACAGTGCACTGGTCTCGACGCGGGTACCAATACGCAGCGTGCGATTGATACTCTGCTCCAC
CTCCTGCGCTTTTTCGTGGAAGCCGCCAAACAGTCCCTGGGTGCCGCCGTCCTTGGCAGCGTTCATCGTACTCACGCTGAACAATCGGATCGCCTCCTGA
ACGTGGTCGCGCGTGGCCTCGTTAAGCAAGTGCATCTTCGCCAGCGATTCCGAAATACGCACGAGGGCTTCGAGCTGTCGGACAGTGACAGGAATCGTGG
TCTCACTGCCCTGTGTACGACGCACGTCGTCACGCACACCAACGTAAAAGTCCTGAAGCGCCTGCGCAGCTCCAACCGACAGCCTCGGTGCGCAGCGAGT
ACGGCAGTACGTGATAAATTTCTTGAGCAGCCACGGCTCGAATTCACCGCCGCTGGAGGAGTTTTCGCTGGCCAAAGATTTGCCAGCAGCCGACGCCAAA
GCGTTTGTGTGCATCCGCACGACGTGTGCAGCCATTTGTCTGTCTCGAGCGTCATCCTGGATATCACGCACGATGAAGATCATGTCGAAACGACTCAGAA
TCGTACTCATGAGGTCAATATTCTCCGAAGCCGAGCGCATGTCGTCGTAGCGACCGAACACGGGGTTGGCAGCGGCCAGCACACTGGCGCGTGAGTTGAG
AATCGTGGTGATACCAGCCTTGGCAATGGAAATGGTCTGCTGCTCCATGGCTTCGTGAATAGCGACACGGTCCGACTCGCGCATCTTGTCAAACTCGTCA
ATGCACACCACTCCACCGTCAGCCAGCACCATGGCGCCTCCTTCCAGATAGAACTCGCCCTTGGAGTCGCGAATCACAGACGCCGTCAGACCTGCTGCAC
TGCTACCTTTACCCGACGTGTACACGCCAACGGGGGCGATTTTCTCCGTAAACTTGAGGAACTGCGACTTGGCCGTACTTGGGTCTCCCAGCAGCAGTAC
GTTAATGTCACCTCGCAAGATCATCCCGTCCGGCAATCGCTTCCTCGATCCTCCAACCAACAAACACGCAATGGCCTTCTTCATATTCACCGTATAGTCA
CCATAAATCGACGGCGCAATGCTGGCCGCCAATTTCGGGTACAGGTTCGGATCTCGTGCCATCTCGTGGAATTTCTCCTCTTCCGCAGGGGAGAACGTGG
CTTTCGCGCGTCCAGCGCCTTCCTCGTCGATCTCAATGCCTACCACCCGCAAATACAGCGTGCGAATAGCCACAGCGCCGACGTTTTTGCCCCCCGCATT
CACGACGGATGTAATGCCCACGACTGACACTCGCGTCCCGGGGGACGCTCTGTCCACCAAGTGGCGGTCCGCAATCAGCGCCAGATTCCGAGGCATTTCG
CCCGTGGGCACCACCTCCGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCCACGTACTCGCCCCTGTCGGGCAGTACAATGTACGAGTCCTTAGGACAAG
CGTCTCCCGGAGCTACGCCATTGTCCTCCTCCCGCATGCGGTCACAAATGCGGGGGATGCTCACGCCGCCCATCCCCGAGACTGCAACACGCTTGACGTG
TCCGCAATTGCGGCAACGTAACGTCGCGGACACGCACTTGGTCCTGACACGAGTGGCACTGATGACGATGCCAGGCACTTTCACCAGTCGATTAATCTCC
TGCGCGTGCACGTGACGAAGTGCGACAGGCGCCTGGTCACTAGTCAGAATGGCCTGGATGTCCGGCAAGTTGGCGGAATGGTTCTCAGATGCGGTCGAAG
TAGCTTCTTGGTTGCCGTTGCCGGTGACGAGCAGCTGTGCCAACATTTCCTTGGCCGCGTTCTCCAGCAGAGGTAGCTGCTCCTTCGGGCTCTTGAGCAA
AAGGTCTTGCAGCTCCTGGTCGAAAGCCGCTACGTGTGACACGTTCACCGTCACGAACCAGTGTTTGCGCCGCGCGTTGGCCAGAAGTTGCTCGCGGTAG
TAAAACAGCGGACCCACACGGAACCCGCGCAGGAAGGCCAGCAGGCGGCGCTGCAACGCGGCAGGGCTCGCGCCCTGACGATCGTCTGACGCCTGCGCGC
TCTCCATGCCCACGGCCGACACGCGACCCGCATCCCAGTCCAT