Description :
From Genome Similarity Track
Location :
Scaffold_444:12151- 13973
Sequence
1822 bases(100 bases per row)
TCATCGGAAGAAGTCTCGTGCTGGTGATACGGCCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTATGTGGCAGTTCAATCTTGTATGCGT
TGCCTAAGCGGCGCAGCACACGAAATGGACTGATGGACTTGGGTAGTAGCTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAGA
TAGTAGGACTAAGTCGCCTTTATTGAATAAAAGAACATTTCCCTTCCATTCTTGTCAGCGTTTCGTTTTTGTCGATCTACCGCCTCTGCGATAGAGTCTT
ATACGAAACGGACAAGCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTAGCTGCAGTGCTCTTGGAGTGTACTACAGCAAGATCACC
TGTCACCTATGTGAGTGTGTTTTTGGACACACTAGGCGTGATGCTAATTTGATCAGTATCGTGGCCAGCAATAGCATCTTTGCTCTTACTTTCGCCTTCT
TCACTGAATTCGATGTGATCGACATCGGCGTCGAACGTGGTGACCGCATTGTCAGCACGTGACGAGTGAGAGCCGGAATGACGGTCGGTCGAATGAGTTC
ATCCCCTCCTTAAACGAGATTCACACTCTAAAAAGGTGGGACGACGTGGATGGCGTAAGCCATTCACGAAGAACGGCGTGTGCTTCATCGACGCGTGGAC
TAAATTGTCGATGGCAAACTTCACCATCGACAGGAATTCGCTCCAATTCGTAATGAAATGGACGTATCCTCGAAGGATCTCCTCGAGGACACGATTGTCG
TGTTCTGTCTGACTATCTGTTTCAGGATGGTCAGGCGTGAACATCTTTAAGCGCGTTCCGAGTGTTTTGAACACGGAACCTTAGAACTCAGCTGTGAACC
GCGGTTCCCGATCGGACACGAGTTCACGAGGCAACCCGTGAAGGCGAAAGACCGTGTCGATAAAGACATGGGCACAAGCCGGTGCGTTGATTGATTCGGG
TACAACCAGATGTACCATCTTGCTGAACCTGTCAACGAACACAAGAATACCATTATTCTTGTGAGAGTCTGCGGGGAATCCAAAGCCAAAGTCCATTGAG
ACAGATTCCCAGCACTCGGCCGGGACGGGCAGAGGCTGCAACGGGGCTCAAAGGGAAGGGCTAGATTTCACCCGTTGACAGACCTCACAGGCCCGAACGT
ACTTGCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGGCTCACTGTGAGATATGTTTTCTCACGACCACGATGTCCGCCAACAGGTGCGTCGTG
GTACTCATACATGATACGCAATCGCAGATCACCATGATCTGGTACGACGACACGAGGTGTGTCGCCGGCAACAGCCGAATATTGGAGTAAGCCGTTGCGA
ACTGTATATATATCTGTAGAGGATCGATATACTGACGACAACTGCTTGAGGCTCTTCCCGGATGGGTGCGAGAGATGATGCATTAATTGCACCATACCCG
GATCATACGTATATCATATGTCTTCCAATAAGGTTGACTACGGGACACTCAAAGTCAGTACCGCGACAGTGGTCCGGCCAGTGTCGGGTAGCACAGCCGG
CTCGAAATCGAGCTGGCGAGAGAGTGGGTCAGCGACAACATTAAGTCGTCCTGGCTTACACTCGACGGAGAAATGATACTCCGCAAAGAATGACAGCCAC
CTCGCTATCCGCTGCGAGAGGTGTGGACTGTTTACGGCCGTGCGTAAAGACGCATGGTCCGTATAAACTATGAAGGTTCTATCACCTAGATGATAGACTC
TGAACTTAGCCAGCGCGTACTT