Description :
From Genome Similarity Track
Location :
contig_47:121502- 127228
Transcript NameFunction/comments
g9188.t1POM70401.1 Nucleolar GTP-binding protein 2 [Phytophthora palmivora var. palmivora
g9189.t1POM73624.1 hypothetical protein PHPALM_9513 [Phytophthora palmivora var. palmivora

Sequence
5726 bases(100 bases per row)
ACGCCTTGGCGGTCGCAATCACTTCTGCTTAGACTCATCTTCCTGGCTATCGGGTTTTTCCTCCTTCTCGTCACCCTCCGCTTCTTCGTCCTCGTCCAGC
TCCACTTCTTCATCCTTGGCTGCCTCAGCCTCATTCAGCGGTGCATCGTCGCCCTTTTGCTCGAGAGCAGCGAGCTCCTCCGCACGCATGGGCGGCGCAA
TGAACCACGGCAGCTTTCCGCGCTGGTAGTCGTTGATCATTTGCACGGCCACATTGTTGTAATCGGGCTCTCCCTTCTGCAGAAGCTTACCGCACTTGTT
GGCAAGCTTCTCGAGGAAATCCCATTCATCCTTCCACTCCTCAATGCCGTACACCTTAATGAGGAACTCCTTCTTGACTCGCTGGAGAATGGTCAAAATG
AAGTCCGTCGGCTGAGGCAGACGCTCAGCACGAACGACACCCTTGAGCACCGTCTCAATCTCGTCATCACCCGTGTCGTACACGATGCCAGGGCAATCGA
TCAAGAAGATGCGACGCATGAGCGTAATGTACTGCCACACCTTGGTCTCACCCGGGATCGGGGCCACCTTGCACACCTTCTTCTTACGTAGTGCGTTAAT
AACCGAGCTCTTACCCACGTTCGGGTACCCAATAAGACCCACTGAGATCTGCTTTTTGTCCTGGTGCAGCTTGGCAAACTGACGCAGTAGGTTGATCAAC
GCACCCTTGCCGAACGGGTTGCTCATGGACGCGTGGAAAGCCAGCGTAGGCGTCGTCTCGCTGAGTTTCTGCACCCAACGCTTGGTAACCCAGTTGGGCA
CCAGGTCACACTTGTTAATGACAAAGATCAAGTGCTTGTGTGACGCGTTCTTGCGGATGTGGTTCTCCACGTGAGAACAACGTGTACCAGGCACGTTGCG
TGCGTCCAGAACCTGAATAACAACGTCGGAACAGTCCAGCACCTTGTAGAGCTCACCCCAAATGCGCTTGGACTGGCCCTTGTTGAACACGTCGTGCGAG
ACCTCCACCTTGAAATCCTGCTCCACCACAATGTTGCGATCGGGTCCCTTGGCCTCGTACTTTTCGGCGTTCTCTTGGGCCTTAGACAGCAGCGCCGCGT
AGTCCGTGGCTGCGACTTTAGCGCGCTTGCGGCTGCGCTTGCCGTTGAAGACCTCGTCGTAACTCTCGGTCTCCAGCAACTTCATGCGGCTCGTCTTCTC
GCTCTCCTGCAGCAGACCCATGGGCAGCTTGCGCGTGCGCAACACCACCGAGTAAGGGTCGGCAGCCTTGAGCGACATCTCGTTGCGGAACTTGTCCAGC
TCCTTCTGACCCACGACCCGCGTGTTGCCAAACCAGCGACGGTCCGGCTGCACGCGTCCGCTGGCACTCGTGATCTCCTGGCCGCCGACCTTGTTCTTCA
TCATGAGGGTGCCGCCGACGACCTTGCCGGCCTTGTTGCGGATGGCACCGCTGTTACGGTACATGTTGAGGCGCTTGATGGTGCTCTTGTCGCGCATGTT
GGCCGCCTTCTGCCGCTTGGGCATCTTGCGGTTGGGGTTGTCGGCCGACGCCTTGGTCGTGTTGAGGCCCTTCGCCATGGCTGCTGCGGTGTTCGACTAC
GGAGTTCGAGAACCGGGAGCGATTCCTCGGGCAGCGCAAATATCGGACAAGTACGCTACGGAGCTCTTCGCAGTCCGTTGGATCGATTGGTTGGACGCGT
CGACGCGCATTTTCATCCACTAAAAAGAAGTCAAGTAGATTTTCAGCCAATCCTCGATGAGATGTCCAATATTAGACACAACCTGACTGTTCTTTCACAA
ATTACAAATGTAGAACATGTACCGGATCAGGTCGCATGTCAGGTTTCATTCTTGAGCAGACGTGAGCCATGGCGACGATGGCGCTCGCGGTACAGCAGCA
GCAGCAGCGCGCGGAGATGGCGTCGTACCTGTACGAGAAGCACCTGACACCAGGACGGTGTGGCCGGTACGCTGAGCATCCGCCTCGTGGCCGCGCGCAA
CCTGCGTGCCGCCGCCTCCATGTTCTGGGTGCGCACATGCAACCCGTACGTGATCTTCCGCGTGGGCAAACAGAGCGTGCGCAGCTCCACGATCCCTGGC
AACGACAACCCGACGTGGCGCCGCGAGTTCCTCGAGGTGAAGCTGCCCAAGTTGCCCCTAAAGCGCCAACCGCTGGGCGAGCACTCGGACGTGCGGCTGG
AGCTCATCGTGGACGCCATGAACGAGGACTCGCTCACGGGAAAAGCCACGGAGGCTGTGGGCATGGCCAGCGGCTCGGTCATCGGCACGGCGTCCGTGGA
CTTGACGCCCCTCGTGGAGGGCAAGGAGGACGTCTTAGACCAGTGGGTCCCACTCAGCGGAGCGCTGCCAATGCCTGGCGCAGGTGGCGCAACGACAGGC
AAGAAACAGCAGCCGGAAGCTGATCTCAGCCTGGGGGAAGTGCGTATGGTGCTACAATACGAGCCGCACGGAATGGAGCCACGAGTGGGCGACGTTGTCA
AGTTCGAGGGCTTTGGCTCGTACCCGTCCGCGGTGCTCGGCCCCGTGGAGGATTTGGAGCTCCATGTGAAGCGGACGAGCGGCAGCTATCTACTGTGCAG
CTACACGACCCCGTCGGGCTACGATGCGGCGCTGCGAGTGCACCGCAACAACGTGTTTGTGGTGCATCGCGGCAGTCTTTTTGACCGCTTCTACGAGTCG
TGCATCGTCGAGCCGCTCGAGTTCGTGGGCAGCACCCCCATCGGCCAGTCGGCCAAGGAAGTGCTGCGTCCGTATATGAACGTGGCCCGCGCTTTCAGTG
GCCCAGCGCTGATTGCAACGAAGGCCACGCTCATGACGACGTACCGCGCCTCTACAGCTGCAATTGGCGCTGTGGTGGCTTCGCTGGACGAGTAAGAGAC
GGCAGTGAGCTGGGAAAGCGTGTAGGTATGAGGCTGGAGCCTTGCAGGCGTAGCACAGTTAGGAGTCAGTGGTAAGTATGAGCCTGCTTTTATTAATAGG
AGGACAATCTGGAGGACAATATGTGCATCATGATTGGCAGATGTAGCCATCTCAGACTTGAAGACACCTCGCCAAGGACGTCGACAAGGTCTCTGGGGCT
CTGGGACAATGCAAGTGCCTGCCACCGCTTCTCCACATACGAATCGGAGCCGCATCAGCGTTGATGGCGTCATCTCGCGAGAGTCTGGACGACTTCCGGT
CACCCTCAGACACGAAGAGCTACCGACTGCTCACTCTGGCAACGGACTGGAAGTTGTGCTCGTCCAGAGCGATGCAGGACGAAGTTCTCGAGTAGATGCC
ACTAGCAACGACGATGACATAGCCCGGGGCAGTCTCAGCTCAACTGACGACACAGATGCTGACAGTGGAGACGAAGGGAAGGAAGAAAACGACCAAGAAG
AGACCAACGATCGAGCTCCACCACAGGCAGCGGCGTGTTTAGCTGTGAATGTGGGCAGTCTAGCAGATCCGGAAGCGCTGCCGGGTCTAGCGCACTATCT
CGAGCACATGGTCTTCATGGGCAGTAACAAGTATCCCACTGAAGACGCGTTTGAAGCTTTCCTTAGTGCTCACGGCGGCTCCAGCAATGGAGCGACCGAG
TGCGAGTCGACACGGTTTGTCTTCGATGTGGACGCTGGCTACCTCGAGCCGGCGCTGGAAATGTTTGCGAGTCTGTTTCTAGCTCCGTTGCTTCGACGAG
AAGCGATGGATCGAGAGCTGAAAGCGGTGGAATCTGAGTTCCAACGTGTCCGAAACAATAATCCGGTTCGTGTGCAGCAGGTCATGTGTGAGACGAGTGT
CCAAGGACATCCGTACTCTCGCTGTTTTACGTGGGGAAATGTGGAGAGCTTAAAGTACAGTCCAGAGCGTGATGGTGTTGACGTTCGTGAGCAAATGGTG
GAATTTTTCAGCAAGCACTACGTAGCGCCGGCCATGAAGCTTTGTGTTTATGGATGTGAACCTCTTGATGTACTGGAGCAGTATGTGACCCAAAGCTTTA
GCGCTATCCCACACAGCCGTAACAACTACGAAGCATCAAAGCATGAGCAGCTACCGGAGCCGTACGGATGTGGAGCAGGCCAGCGACCAAGCATTTTACG
CGTCATTCCTGTAGGTGAGAAGCGCTCTATGCGCTTGTACTGGATGCTCCCAGCGATGATGGAGAAGTATCGGCAGAAGCCTTGGTATTACGTAGGTCAC
TTGTTGGGTCACGAAGGCCCAGACTCAACAGCATCGGTTCTCAAGCGCCGAAAGTGGGCTACCGACCTTATCGCTGGGACGTCGGATCGAGATGCTTACG
AATTTGGTTCCTTTGGCACTGTGTTCGAGGTTCGAGTAGCTCTCACGAAAGAAGGTCTGGCTTGTTGGGAACAGGTTGTGCAGCTTGTATTTGATGCTCT
GCAACTCTTCTCTGCTAAGGCAGCAGAGGATGGTTTGCCCGATTGGCCTTATGAGGAGCTCCGCTCGTCCAGTGAAATGGATTTTCGATTCCAGGAAGAT
GCCAAAGCACCAGTGTCACTTTGTCGCGAGCTTAGTGAGCGAATGCTTCCACGTCACCATGTACTGCAAACGTGCCAAGGAGATCTACTGCGTTACGATC
TGATTCAGGGTGTATTCGACAATTCGTCCGTGTCTGCCTTCCTGGCTGGGCTTTCTGCTGATAACGTTCGTGTCGTTCTGTTGGCGTCCTCATTTGGTGG
CGATTTTAACTCGGAAGAACTCCGGACTGAACGATGGTTTGGCACCAAGTACACCGTGAATCGAATACCTGATGTTGTGCTTGCTGCTTGGTCGCAGAGC
TCGGGGGAATTTGCAGGGGTTTCGCCATTGCCAGCACCTAATCCTTTTATGCCTCGGGACTTCTCAGTGCTGCCTTGTGAACCGGCCACTCAAAATGACA
GCAACATCCCTCCAGACCTCATTCTCACCACTACAGCAGCGCAACTATGGTACAAGCGTGATCGCACCTTCTTGGTTCCCAAAGCCAGCGTGAGCTTTTT
CGTGACACTTCCCGCTTCAACTGCAGTGAATTACATGCTTGCTGAGCTGCATGTCGAAGTAGTCCGCCATCGATTACAGCACACACTGGAGCAAGCTGGC
GCTGCAAGCTTTGACGTTGAGTTGGATGTTCGAGACGAGGCTATAGAGGTTGTGATTTCAGGTTTCAGCGACTCATTGCCAGCGCTCGTTCGATCCATCA
TGCAAGAGGTTTTGAGTCCACCAATAGCGTCCGAGGTTGTATCGGAGTTGACACTTGCTCGGATTGAGCTTGAGCGAGAGTACCGCAATGCAACGCTATC
TCCTCGAGAGAAAGCGTATGAATTACGTCTTCAAATGCTTGAAAGCAGAGCCGTTTCCACGGATGACAAGTTGGAGGCACTTCAAAGCAAGTATGGTCGT
GAAAAAGAGCTTGCAGCTGACCTCGCACATTTCACGGCCACTGTTCTCGGGCGAAACGAAGGTGTTCCAGCGACACGATGCCTAGTGATCGGGAACATGA
GTCGAGATGCTGCCATAACACTGGTGCTAGACGTTGAAGCCGTCATGGCTGGAAATACTGTTTCTCCTCTGGCTTACGAACCGGACTTGGAGCTTGAACC
TGAACCTCCCCTTTTGGTTCCACGTTGCCACACGATCGCTCTGCCGTCTACGACGAATGGTTTGCTTTTGCGTCGTCAAAGTGAGCGAGTCGGCGAGCGC
AATTCAGTGGTAGAGGTGTATTTCCA