Description :
From Genome Similarity Track
Location :
contig_47:121485- 127211
Transcript NameFunction/comments
g9641.t1POM70401.1 Nucleolar GTP-binding protein 2 [Phytophthora palmivora var. palmivora
g9642.t1hypothetical protein

Sequence
5726 bases(100 bases per row)
ACGCCTTGGCGGTCGCAATCACTTCTGCTTAGACTCATCTTCCTGGCTATCGGGTTTTTCCTCCTTCTCGTCACCCTCCGCTTCTTCGTCCTCGTCCAGC
TCCACTTCTTCATCCTTGGCTGCCTCAGCCTCATTCAGCGGTGCATCGTCACCCTTTTGCTCGAGAGCAGCGAGCTCCTCCGCACGCATGGGCGGCGCAA
TGAACCACGGCAGCTTTCCGCGCTGGTAGTCGTTGATCATTTGCACGGCCACATTGTTGTAATCGGGCTCACCCTTCTGCAGAAGCTTACCGCACTTGTT
GGCAAGCTTCTCGAGGAAATCCCATTCATCCTTCCACTCCTCAATGCCGTACACCTTAATGAGGAACTCCTTCTTGACTCGCTGGAGAATGGTCAAAATG
AAGTCCGTCGGCTGAGGCAGACGCTCAGCACGAACGACACCCTTGAGCACCGTCTCAATCTCGTCATCACCCGTGTCGTACACGATGCCAGGGCAATCGA
TCAAGAAGATGCGACGCATGAGCGTAATGTACTGCCACACCTTCGTCTCACCCGGGATCGGGGCCACCTTGCACACCTTCTTCTTACGTAGTGCGTTAAT
AACCGAGCTCTTACCCACGTTCGGGTACCCAATAAGACCCACTGAGATCTGCTTTTTGTCCTGGTGCAGCTTGGCAAACTGACGCAGTAGGTTGATCAAC
GCACCCTTGCCGAACGGGTTGCTCATGGACGCGTGGAAAGCCAGCGTAGGCGTCGTCTCGCTGAGCTTCTGCACCCAACGCTTGGTAACCCAGTTGGGCA
CCAGGTCACACTTGTTAATGACAAAGATCAAGTGCTTGTGTGACGCGTTCTTGCGGATGTGGTTCTCCACGTGAGAACAACGTGTACCAGGCACGTTGCG
TGCGTCCAGAACCTGAATAACAACGTCGGAACAGTCCAGCACCTTGTAGAGCTCACCCCAAATGCGCTTGGACTGGCCCTTGTTGAACACGTCGTGCGAG
ACCTCCACCTTGAAATCCTGCTCCACCACAATGTTGCGATCGGGTCCCTTGGCCTCGTACTTTTCGGCGTTCTCTTGGGCCTTAGACAGCAGCGCCGCGT
AGTCCGTGGCTGCGACTTTAGCGCGCTTGCGGCTGCGCTTGCCGTTGAAGACCTCGTCGTAACTCTCGGTCTCCAGCAACTTCATGCGGCTCGTCTTCTC
GCTCTCCTGCAGCAGACCCATGGGCAGCTTGCGCGTGCGCAACACCACCGAGTAAGGGTCGGCAGCCTTGAGCGACATCTCGTTGCGGAACTTGTCCAGC
TCCTTCTGACCCACGACCCGCGTGTTGCCAAACCAGCGACGGTCCGGCTGCACGCGTCCGCTGGCACTCGTGATCTCCTGGCCGCCGACCTTGTTCTTCA
TCATGAGGGTGCCGCCGACGACCTTGCCGGCCTTGTTGCGGATGGCACCGCTGTTACGGTACATGTTGAGGCGCTTGATGGTGCTCTTGTCGCGCATGTT
GGCCGCCTTCTGCCGCTTGGGCATCTTGCGGTTGGGGTTGTCGGCCGACGCCTTGGTCGTGTTGAGGCCCTTCGCCATGGCTGCTGCGGTGTTCGACTAC
GGAGTTCGAGAACCGGGAGCGATTCCTCGGGCAGCGCAAATATCGGACAAGTACGCTACGGAGCTCTTCGCAGTCCGTTGGATCGATTGGTTGGACGCGT
CGACGCGCATTTTCATCCACTAAAAAGAAGTCAAGTAGATTTTCAGCCAATCCTCGATGAGATGTCCAATATTAGACACAACCTGACTGTTCTTTCACAA
ATTACAAATGTAGAACATGTACCGGATCAGGTCGCATGTCAGGTTTCATTCTTGAGCAGACGTGAGCCATGGCGACGATGGCGCTCGCGGTACAGCAGCA
GCAGCAGCGCGCGGAGATGGCGTCGTACCTGTACGAGAAGCACCTGACACCAGGACGGTGTGGCTGGCACGCTGAGCATCCGCCTTGTGGCCGCGCGCAA
CCTGCGTGCCGCCGCCTCCATGTTCTGGGTGCGCACATGCAACCCGTACGTGATCTTCCGCGTGGGCAAACAGAGTGTGCGCAGCTCCACGATCCCTGGC
AACGACAACCCGACGTGGCGCCGCGAGTTCCTCGAGGTGAAGCTGCCCAAGTTGCCCCTAAAGCGCCAACCGCTGGGCGAGCACTCGGACGTGCGGCTGG
AGCTCATCGTGGACGCCATGAACGAGGACTCGCTCACGGGAAAAGCCACGGAGGCTGTGGGCATGGCCAGCGGCTCGGTCATCGGCACGGCGTCCGTGGA
CTTGACGCCCCTCGTGGAGGGCAAGGAGGACGTCTTAGACCAGTGGGTCCCACTCAGCGGAGCGCTGCCAATGCCTGGCGCAGGTGGCGCAACGACAGGC
AAGAAACAGCAGCCGGAAGCTGATCTCAGCCTGGGGGAAGTGCGTATGGTGCTACAATACGAGCCGCACGGAATGGAGCCTCGAGTGGGCGACGTTGTCA
AGTTCGAGGGCTTTGGCTCGTACCCGTCCGCGGTGCTCGGCCCCGTGGAGGATTTGGAGCTCCATGTGAAGCGGACGAGCGGCAGCTATCTACTGTGCAG
CTACACGACCCCGTCGGGCTACGATGCGGCGCTGCGAGTGCACCGCAACAACGTGTTTGTGGTGCATCGCGGCAGTCTTTTTGACCGCTTCTACGAGTCG
TGCATCGTCGAGCCGCTCGAGTTCGTGGGCAGCACCCCCATCGGCCAGTCGGCCAAGGAAGTGCTGCGTCCGTATATGAACGTGGCCCGCGCTTTCAGTG
GCCCAGCGCTGATTGCAACGAAGGCCACGCTCATGACGACGTACCGCGCCTCTACAGCTGCAATTGGCGCTGTGGTGGCTTCGCTGGACGAGTAAGAGAC
GGCAGTGAGCTGGGAAAGCGTGTAGGTATGAGGCTGGAGCCTTGCAGGCGTAGCACAGTTAGGAGTCAGTGGTAAGTATGAGCCTGCTTTTATTAATAGG
AGGACAATCTGGAGGACAATATGTGCATCATGATTGGCAGATGTAGCCATCTCAGACTTGAAGACACCTCGCCAAGGACGTCGACAAGGTCTCTGGGGCT
CTGGGACAATGCAAGTGCCTGCCACCGCTTCTCCACATACGAATCGGAGCCGCATCAGCGTTGATGGCGTCATCTCGCGAGAGTCTGGACGACTTCCGGT
CACCCTCAGACACGAAGAGCTACCGACTGCTCACTCTGGCAACGGACTGGAAGTTGTGCTCGTCCAGAGCGATGCAGGACGAAGTTCTCGAGTAGATGCC
ACTAGCAACGACGATGACATAGCCCGGGGCAGTCTCAGCTCAACTGACGACACAGATGCTGACAGTGGAGACGAAGGGAAGGAAGAAAACGACCAAGAAG
AGACCAACGATCGAGCTCCACCACAGGCAGCGGCGTGTTTAGCTGTGAATGTGGGCAGTCTAGCAGATCCGGAAGCGCTGCCGGGTCTAGCGCACTATCT
CGAGCACATGGTCTTCATGGGCAGTAACAAGTATCCCACTGAAGACGCGTTTGAAGCTTTCCTTAGTGCTCACGGCGGCTCCAGCAATGGAGCGACCGAG
TGCGAGTCGACACGGTTTGTCTTCGATGTGGACGCTGGCTACCTCGAGCCGGCGCTGGAAATGTTTGCGAGTCTGTTTCTAGCTCCGTTGCTTCGACGAG
AAGCGATGGATCGAGAGCTGAAAGCGGTGGAATCTGAGTTCCAACGTGTCCGAAACAATAATCCGGTTCGTGTGCAGCAGGTCATGTGTGAGACGAGTGT
CCAAGGACATCCGTACTCTCGCTGTTTTACGTGGGGAAATGTGGAGAGCTTAAAGCACAATCCAGAGCGTGATGGTGTTGACGTTCGTGAGCAAATGGTG
GAATTTTTCAGCAAGCACTACGTAGCGCCGGCCATGAAGCTTTGTGTTTATGGATGTGAACCTCTTGATGTACTGGAGCAGTATGTGACCCAAAGCTTTA
GCGCTATCCCACACAGCCGTAACAACTACGAAGCATCAAAGCATGAGCAGCTACCGGAGCCGTACGGATGTGGAGCAGGCCAGCGACCAAGCATTTTACG
CGTCATTCCTGTAGGTGAGAAGCGCTCTATGCGCTTGTACTGGATGCTCCCAGCGATGATGGAGAAGTATCGGCAGAAGCCTTGGTATTACGTAGGTCAC
TTGTTGGGTCACGAAGGCCCAGACTCAACAGCATCGGTTCTCAAGCGCCGAAAGTGGGCTACCGACCTTATCGCTGGGACGTCGGATCGAGATGCTTACG
AATTTGGTTCCTTCGGCACTGTGTTCGAGGTTCGAGTAGCTCTCACGAAAGAAGGTCTGGCCTGTTGGGAACAGGTTGTGCAGCTTGTATTTGATGCTCT
GCAACTCTTCTCTGCTAAGGCAGCAGAGGATGGTTTGCCCGATTGGCCTTATGAGGAGCTCCGCTCGTCCAGTGAAATGGATTTTCGATTCCAGGAAGAT
GCCAAAGCACCAGTGTCACTTTGTCGCGAGCTTAGTGAGCGAATGCTTCCACGTCACCATGTACTGCAAATGTGCCAAGGAGATCTACTGCGTTACGATC
TGATTCAGGGTGAATTCGACAATTCGTCCGTGTCTGCCTTCCTGGCTGGGCTTTCTGCTGATAACGTTCGTGTCGTTCTGTTGGCGTCCTCATTTGGTGG
CGATTTCAACTCGGAAGAACTCCGGACTGAACGATGGTTTGGCACCAAGTACACCGTGAATCGAATACCTGATGTTGTGCTTGCTGCTTGGTCGCAGAGC
TCGGGGGAATTTGCAGGGGTTTCGCCATTGCCAGCACCTAATCCTTTTATGCCTCGGGACTTCTCAGTGCTGCCTTGTGAACCGGCCACTCAAAATGACA
GCAACATCCCTCCAGACCTCATTCTCACCACTACAGCAGCGCAACTTTGGTACAAGCGTGATCGCACCTTCTTGGTTCCCAAAGCCAGCGTGAGCTTTTT
CGTGACACTTCCCGCTTCAACTGCAGTGAATTACATGCTTGCTGAGCTGCATGTCGAAGTAGTCCGCCATCGATTACAGCACACACTGGAGCAAGCTGGC
GCTGCAAGCTTTGACGTTGAGTTGGATGTTCGAGACGAGGCTATAGAGGTTGTGATTTCAGGTTTCAGCGACTCATTGCCAGCGCTCGTTCGATCCATCA
TGCAAGAGGTTTTGAGTCCACCAATAGCGTCCGAGGTTGTATCGGAGTTGACACTTGCTCGGATTGAGCTTGAGCGAGAGTACCGCAATGCAACGCTATC
TCCTCGAGAGAAAGCGTATGAATTACGTCTTCAAATGCTTGAAAGCAGAGCCGTTTCCACGGATGACAAGTTGGAGGCACTTCAAAGCAAGTATGGTCGT
GAAAAAGAGCTTGCAGCTGACCTCGCACATTTCACGGCCACTGTTCTCGGGCGAAACGAAGGTGTTCCAGCGACACGATGCCTAGTGATCGGGAACATGA
GTCGAGATGCTGCCATAACACTGGTGCTAGACGTTGAAGCCGTCATGGCTGGAAATACTGTTTCTCCTCTGGCTTACGAACCGGACTTGGAGCTTGAACC
TGAACCTCCCCTTTTGGTTCCACGTTGCCACACGATCGCTCTGCCGTCTACGACGAATGGTTTGCTTTTGCGTCGTCAAAGTGAGCGAGTCGGCGAGCGC
AATTCAGTGGTAGAGGTGTATTTCCA