Description :
From Genome Similarity Track
Location :
Scaffold_339:12142- 15101
Sequence
2959 bases(100 bases per row)
GACCGGCAGAAAAGGAACGCTGATCAATATGGAAGAATTTAATGTCGAGACTTCGTTCTACTGTCCACGATAAATCAACGGACAATTTACCTAAACATGT
AGTAATAATGTGGGTAGCAGTAACCTACTACCCAAGTACATAGACCCCTTTCTTGTACCGCATCCCACTGGAAATGCGTACGCGATCGAGTTGCCTCGTA
GAATGCACTCAAATCCTACGTTCTAGGTGGGCGGCTCCGGCCGTACTATCAGAACGCATCTTCCGTCGAGGACGAATGCAGCTACCACGCTAAAGAATCG
CGAGTAAATTCTTGTGGTCACGGACCAGGGTCTCAAGCTGCCTATGAAGTGACGCGATCTCGCGACGACCTGATGACAGATTATCACGAAGGGCTTGACC
CCTTTGCTCGTTCTCCAGCTGGGAGAACGCGTATTCCGATCGTTTGTCCGATTGATAGACACAAAGACGCTTTAGCTTTGCCTCATATTCGCGACGTGCA
TCACGCTCGTGATCGATGTCATCACGCATCTCAAAAGGACGCGGTCGTGCTGCTCGACCCGAAGGTCCGACAAGCAGATCGGACCTGGTATCCCCTCCAT
CAGCACAGCCGCTGGTGGACTCGCAGGGTATCCAACAATTCCACGTGAAGCGTATCTTGAACCACAATGCCGTGAAGGAGAATCGAACGAGGTACCTCAT
TCGCTGAAACGGCTATCCGTCGTCGCAGACAGCTGGGGGCCACGCGTTCAACTGATGACCGATGTTGAGGTTCTCGTCCATCAGTATGACGAGACCCATC
CTCTGACTCAGAGAGTCTATCGGAAAACACGCACCCATGGCGCATGCAGAGAAATAGCAAACTAGCTATCACGTCACGCAACTCACTTAAGATGTGAGTC
CTTCCTTAGGGCGAAGAAAGAGTGTAAAAATTCCTTTGGGCGCGCTTCGTATGACGGACAACACGGGCGTGGGTCGCCCCACGTGAGGCATGAGATTCCT
ACCTCACCAGAAAAACGATACAATTTAACCTTTGCACCGGTTGGAGTACGCTTATCAGATCTAACGCGAGCCGTGATAGGATTTCAAAGCCAGACTTCGC
ACCCAATGTCTTCGACATTGCGGATGAACGTGTTCCAAGCCTGTAACAGAGAGGATTTGTCCCGTTTGGGGTTGACGCTGTAATGAAAGAAGATTTACAT
CTCGATGCTTTAAAAAAGCTTCAAGATAAAAATCTTCTTTATCTCGAAAGTCGCTCGCTACAAAACAAGACCATGCAGCATGCTTGCATCGAATAGTGGT
AGTTGATGATGCGCACTTGGACAAGTCGTTGATGATATGCTGCAGCAAAAGCCAGGTCTTGCACTCAGGGGAAAGGCGCGACACATTGCGGTCTTTAGCC
TCCTGTGTGGTACCAACAGAAGTTGTGGTACCACGATATTCGCGTCCAGGTGGCGCGAGCCATCGTCGTGCTTGTGCTCTAGTTTAATGCGCAGCATCAA
AGACAGGCGACTAGGCATCTTCATCCTCCAAATCGAACAGACTATGGTAGTGGCCATTAGTCTGAGTGTTCGACCGAGCGTTTTTGACCAAAGGCTCATA
ATCAGCTGCCACGGGTGATCCGGGTGACCTAACAGTCTTCTTTGAGTCGGACTCTTTGTCCGACTCACCAGCATAGATGAGCTCCAATGGGGAGCAATCG
TCAGCACGTGATGACACAATATGTGCACCTGCAGCAACTGATGCTGCAGGTTACGGGGGGAGGGGCTAACAGTAGACGACGCATCGTCCGCCGCGTGGGC
TCTAGTCGCGCATAGCATGGACTTTGATACCATGTGATGAAAAGTCAAAAATGAATGGATCCGACCAAACAAGTGCTCCCTGTCTCTTAGCGTGGTCTAA
CGGTGACCACTCAAAAACATGATAGTCAATGGGTGACTATCGTTTCAGGGAGGGTAACAGGGTGAGCCTGTTACATTTAATTAACATCCAATAACTGTTA
GCTAGAATATTATCTAAAAGGCAGATAATATTCAGGAATATTACCTTAATCGGTGATGTTTTAGAGACACTTGCTCATTGGCTGATATGGGCCATTATAT
CGATATCTCAGTGGTCCAATCAATGATGGACGCGCGAAATGAGTGGCGAGCAAGACTTCTCCATACATTCTTGGAGATAAATATAATTAAGTCAGGACTA
AAACATAGGTTAATGATCAGGACTTAATTATATTCACTACAGTTTCACTTTCCACCTCTATTAGACTAGTGTGTAATAGTTAGTATTCCTCGCACGTAAT
GTGTACGTGAAGTGACGTGCGGTACTACTTACACTGTGTCAGTTTAAGTTGACTTGTACTGTGTTGGTACAAGTCACCAGTATCCCGTTACAGTCCGACT
CGTCGAACGACCGAAGGTGTCACGCCGTTCTCACAGATCTTTGTAAAGCCGACTTGGGGCAGCTTCGGTTTTAGCCACTTCTGGCTCACTCTCGGCTTCC
TCAGCCTTCTTCGATTCGGAACATTATCCGACTCTCCGGAGTACACGAACTTGAGTTTGCAGTCTTCAATATAAAGTAGTACATCACCACGTGAGCCTAG
AACGGCTACTTCTGCAGGCTGTAGTGCAGAAGCATCAGACGAGTTTCCGCATGCCGCTTGCGTTATCACGGTCTGTCTTGAAAGCATTACTTGAGACGTC
GTAGGCTCTTCTGCAGCCACTGCACGAAGCCTGGCAGCTGCACTCTCTGCAGCTTTTGCCACCAATCGCATGGACTTGATAATCATGCGATGAGAACAGT
GAATGAATGGTGTAGACCAACAAGTGCTCCCTTTCCCAGAGTCACTCAAGAGAGTCAATCGATCATTCAGTCACTAATGTGACTGATGTTCAAGGGGGGG
GGTAGTGTAACGGGGTGACTCCGTTACATAATCTTCTACATAAGGTAAATATCAAGTAT