Description :
From Genome Similarity Track
Location :
scaffold_509:12142- 13682
Transcript NameFunction/comments
g8872.t1 hypothetical protein PHYSODRAFT_515489

Sequence
1540 bases(100 bases per row)
TCGCCTTCCAGAGCCGCTTCTTGCGCGTGTTGCGGGGTTTCTGACCGTCCCAGACTTCTCTCGTGTGGCTCAAACAAACAAAGTGGGGCTGTGTCTGCTT
CGGCTGTAGTATGTGTCTTGAGCTTTGACTTTGATTGTGATTGTAGTATTTGCATCAGTTGCAGGAGTCTGGAGAATACTGGCAGGAATTTCTACGACGA
GGTAGGGCGTAGAGTAGTGGCTGTAGAGCGCCTCGTGCTCAATGCTCGGCTTGTTATTGTAGACTACCCGATGCTGCATGGCGAGGGAGATCCGAAAGCG
CTCTACATCTCACATTGGACCCGCCAGAAGAGAATGGAAGCATGGACCCAGAGCGAACAAGAGCGTCGACTTCGTGCCTTTATGCTTCGTCGGCAAAACC
ATTGGCGCTGGCGAGGCGGAGGGCGACTACCTGCACCACCACTACATCTCCCGCCTCCACCTTTCCTCCCACTTGGGGGAGATCCATGGTCGTTTCGATC
GCCGCCCCACCGATCTACTGGGTGATGAGGACGTGGAGCCGTTTACGTTCTACCTTGACCCGCGCTTCTACTGATCGAAAGGAAGTAGCACGCAGCATCC
ATTTTTGGAGAGGTATTTATGAAATTTAACGGCACACAAAAGCAAACCAAACGGACGAAGAAGCTTTTCAGTCGTAGTGCCTCTCTTTTGTAGCTCATGC
GGTGGGGTAGTACCGGGAACAACGTGGGCGTTGGGGATACTTTAAACGACAATAAGAGGTACTACTACTACCAAGAACCAGTGGGGCCCTTAGGACTCTC
TCACGGCCAACCACGTGGAGTTGCTCAAGCGAAGAATCCTCCTGGTAAACAACAAAGGAGCAAGGCTCGCTCTGCCAATATATTGAAAAATGCAGCGGTA
GAAGCCAATTCAGAAGTCGAGCCAGGCCATGCGCCGTTGATCATGTGCGCTGGGAGACGGTTCTATGGCTTGAACAGCGACTTGAGCAGCGAAGATCGCG
ACAACAACCACAGAGAGGACTCCGGTAGACCGGGTAGTATCGGAGGCGATAAAAACCCACCACCCAACAATCAGCCAGAATCTTTTACAATCAAGACAAA
CACGTATTCGCCTCTACGACAACACACAGACGAAGAACTGGAGCAGATTATTCGAGATCTACGCGACCAGGTTTTCCAGAAACAAGGGCAGAAGTCTATC
AACAACGAGCCTTCGAGTGAAACTACTCAAGCACAGAGGCATTCCCGCAAACACTTGAAGAACCCCGTGGAGAAGATGGACGCTGTTAAAGTGCCTGTAG
CTTCAAGTATTGGTTCTACATCTCACGAGCTTTTGCATCGGCCACTGTCCAGCAGCCAACTCAATCGACTTGTGGCCGAAAACACCATCCAAATGGTCGT
TCCTGCTGTCATGTCCGCATCACCCTCTACAGCGAGAATTGCAGGTAGAACGACTAGTAGTCCGCAAGTTTCTTCCTTGGACTTGAGCTCTCTGCGAAGA
TCCAGACCCAATTCCAGTTCTGTTAACCCTCGGTCGAAGC