Description :
From Genome Similarity Track
Location :
contig_9:121412- 123653
Transcript NameFunction/comments
g2224.t1hypothetical protein L914_16304, partial
g2225.t1DNA replication licensing factor MCM5

Sequence
2241 bases(100 bases per row)
TAGACTCGAGTGCAGGACTACTTGACGCGGGATACAAACTTGTACTGGCTCAGCTGTCGGAGGGAGCCCTTCTGCACCATAGCTCGAATCGCGCGTTGAA
TAGCGTTGGGGTTGTAGCCCTGCGCCTCGAGGCGGCTGTACAGTGCACTGGTCTCGACGCGGGTACCAATACGCAGCGTGCGATTGATACTCTGCTCCAC
CTCCTGCGCTTTTTCGTGGAAGCCGCCAAACAGTCCCTGGGTGCCGCCGTCCTTGGCAGCGTTCATCGTACTCACGCTGAACAATCGGATCGCCTCCTGA
ACGTGGTCGCGCGTGGCCTCGTTAAGCAAGTGCATCTTCGCCAGCGATTCCGAAATACGCACGAGGGCTTCGAGCTGTCGGACAGTGACAGGAATCGTGG
TCTCACTGCCCTGTGTACGACGCACGTCGTCACGCACACCAACGTAAAAGTCCTGAAGCGCCTGCGCAGCTCCAACCGACAGCCTCGGTGCGCAGCGAGT
ACGGCAGTACGTGATAAATTTCTTGAGCAGCCACGGCTCGAATTCACCGCCGCTGGAGGAGTTTTCGCTGGCCAAAGATTTGCCAGCAGCCGACGCCAAA
GCGTTTGTGTGCATCCGCACGACGTGTGCAGCCATTTGTCTGTCTCGAGCGTCATCCTGGATATCACGCACGATGAAGATCATGTCGAAACGACTCAGAA
TCGTACTCATGAGGTCAATATTCTCCGAAGCCGAGCGCGTCGTCGTAGCGACCGAACACGGGGTTGGCAGCGGCCAGCACACTGGCGCGTGAGTTGAGAA
TCGTGGTGATACCAGCCTTGGCAATGGAAATGGTCTGCTGCTCCATGGCTTCGTGAATAGCGACACGGTCCGACTCGCGCATCTTGTCAAACTCGTCAAT
GCACACCACTCCACCGTCAGCCAGCACCATGGCGCCTCCTTCCAGATAGAACTCGCCCTTGGAGTCGCGAATCACAGACGCCGTCAGACCTGCTGCACTG
CTACCTTTACCCGACGTGTACACGCCAACGGGGGCGATTTTCTCCGTAAACTTGAGGAACTGCGACTTGGCCGTACTTGGGTCTCCCAGCAGCAGTACGT
TAATGTCACCTCGCAAGATCATCCCGTCCGGCAATCGCTTCCTCGATCCTCCAACCAACAAACACGCAATGGCCTTCTTCATATTCACCGTATAGTCACC
ATAAATCGACGGCGCAATGCTGGCCGCCAATTTCGGGTACAGGTTCGGATCTCGTGCCATCTCGTGGAATTTCTCCTCTTCCGCAGGGGAGAACGTGGCT
TTCGCGCGTCCAGCGCCTTCCTCGTCGATCTCAATGCCTACCACCCGCAAATACAGCGTGCGAATAGCCACAGCGCCGACGTTTTTGCCCCCCGCATTCA
CGACGGATGTAATGCCCACGACTGACACTCGCGTCCCGGGGGACGCTCTGTCCACCAAGTGGCGGTCCGCAATCAGCGCCAGATTCCGAGGCATTTCGCC
CGTGGGCACCACCTCCGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCCACGTACTCGCCCCTGTCGGGCAGTACAATGTACGAGTCCTTAGGACAAGCG
TCTCCCGGAGCTACGCCATTGTCCTCCTCCCGCATGCGGTCACAAATGCGGGGGATGCTCACGCCGCCCATCCCCGAGACTGCAACACGCTTGACGTGTC
CGCAATTGCGGCAACGTAACGTCGCGGACACGCACTTGGTCCTGACACGAGTGGCACTGATGACGATGCCAGGCACTTTCACCAGTCGATTAATCTCCTG
CGCGTGCACGTGACGAAGTGCGACAGGCGCCTGGTCACTAGTCAGAATGGCCTGGATGTCCGGCAAGTTGGCGGAATGGTTCTCAGATGCGGTCGAAGTA
GCTTCTTGGTTGCCGTTGCCGGTGACGAGCAGCTGTGCCAACATTTCCTTGGCCGCGTTCTCCAGCAGAGGTAGCTGCTCCTTCGGGCTCTTGAGCAAAA
GGTCTTGCAGCTCCTGGTCGAAAGCCGCTACGTGTGACACGTTCACCGTCACGAACCAGTGTTTGCGCCGCGCGTTGGCCAGAAGTTGCTCGCGGTAGTA
AAACAGCGGACCCACACGGAACCCGCGCAGGAAGGCCAGCAGGCGGCGCTGCAACGCGGCAGGGCTCGCGCCCTGACGATCGTCTGACGCCTGCGCGCTC
TCCATGCCCACGGCCGACACGCGACCCGCATCCCAGTCCAT