Description :
From Genome Similarity Track
Location :
Scaffold_108:121401- 123163
Transcript NameFunction/comments
Hyaar_Emoy2809735phosphatidate cytidylyltransferase putative
Hyaar_Emoy2809734phosphatidate cytidylyltransferase putative

Sequence
1762 bases(100 bases per row)
AAATTTATGACGCGCGTGGTCATGAGCTTCGCTATGATCGGCGGGTTCGTCGCGATTCTGTACGGTGGCCACATGTACGCTTGGGGACTCGTTGTCGTGC
TCCAGACGCTGCTGTTCCGTGAACTGGTCAACGTGCGCTATCGAGCTGCAGCGGAGAAGAGCATCCCGTGGTTCCGCTCGGTGCAGTGGATGTGGTTTGT
CGTCGCGCTCTTCTACAATTACGGCGACTCGTTTGGCGCGTTCATTGAAAGCAGCAAGATCCGGGTTGTACCGCCTGCAATTGTGCACTATCTGCGGTAT
CATACGTGGGTCTCGTTTACAATGTACGCGCTGCTCTTCGTCATGTCGGTACTGAGTCTGAAGAAAGGTGCGTCACTTGCTGCAAGCAACTTGAGGGACG
GCGATGTGGCTGTTTTGTGACTGATTTATTGCTGTTGTTGTTGTTGTTGTTGGACCACGCTCACTTTGTGATGATCTTATAACATGATGGCTTCATCGAT
CGGTTGATAAATTGATTGATTGATAAGGATACTACAAGTACCAAATGGGCAAGTCTACGAAAGTCTCGTGTTTTTGGATGTAATCGTGATTGCTGACTGT
CGTTGAGTGTTTATCTGCTTCTTCTTTAGGACAATACACATGGACGATCGTGACGCTGGGTCTGATCGTCTTTCAGATGAAATACGTACTCACGAACATC
TTTAACGGTACGTTGAGCTTTTCGAATGCTGATCAGAACTGAGTGTTTGTGTTATGCAATTGAGACTGACTCGATCGTGCGTGTCAATAAGGTCTGTTTT
GGTTCTTGTTCCCCGTTTCGGTGGTGATTTGCAACGACTGTTTTGCATTTTTCTGCGGAAAACTCTTTGGTCGCAAGTTCATCAAGACACCGTTCCTGCG
CTTGTCTCCGAACAAGACGTGGGAGGGATTCATCGGTGCTCTTTTGTGCACCATTGTGTTTGCCTTCTTCTTTAGCGCTTTCATTTCTCAGGTACGATTG
TGTGAGGTGGCTTGTTGTTGTCATAGTGAAGGCTCATTGGATAATGTGTGGTTTATTACGTTTCAGTTTTCATGGCTTACCTGCCCAGTCGAGAGCTTTG
AGGCACATTTTGTGTTGTTGGAGTGCAGGATTGCAGCTCCGATTGCTAATCGATACTGTTTGAATCTTTGTGTGCTACAGTTTAAGCTGATCCCCGACCC
ACTTACGTGCACTCCTCACGACGTATTTCTCTCGCACTCTTATGACGTGCCGGTCTTTATCGCGCGTGTAATCAACCGCAGCCAGATTCAGCTTCTTCCG
ATCCAGGTTTCTGGACTTGTTGTGAGTTGTAGTACCCATCGTGATGACTGACATTTGAACATATTGGTTTTGGATGCAGCTCCACTCGTTCTGGTTCGCA
ATTTTCGCATCGATCATTTCGCCCTTTGGCGGGTTCTACGCATCAGCGATCAAGCGCACATATCACCTAAAAGACTTTGACTCGGTTATTCCAGGCCATG
GTGGTGTCATGGACCGGATGGATTGCCAACTTATCACCAATTGCTTTACGACAGTCTACTTTAACACTTTCATCCGGTACGCACGAGCAACCGAGCTTAT
TGCATCACGTTTCTCGCCCTACTGACTGGAAGATGAGTGTCTGCTCTTTTTTCGTATAGGTCGCAGATCCCGTCCGTGGCGATGATTTTGAACCTCGTGG
CAAAGTTGACGGTCGAGCAGAAGCAAGATGCGCTGCAGGCCATTCAAGAGATGTTGCAAAGC