Description :
From Genome Similarity Track
Location :
Scaffold_263:1214- 3092
Transcript NameFunction/comments
g14712.t1hypothetical protein
g14713.t1XP_008898422.1 hypothetical protein PPTG_06273 [Phytophthora parasitica INRA-310

Sequence
1878 bases(100 bases per row)
GAGAGCGCCACCTGGGTCATCGCCGGACACGCGTGTGCCTTCTTGATAAGACCTGTCTTCTGCTCTCTCTTCATCCAGCCCATGGGGCGGAGCGTGCGAG
GAAGTGCTTGCGTTGTGATGTGAGATGAATGGTGCGTGGCGATTCCCGCCATAAGTGAAGCTGTGTCACCTGTCTAAAACGATTCTATCAGACGATTCGG
GGTATTTTTCATAAGTGGTACCGGAACAGAGAGCGCTTACTGTAGCTGCTTGATGAGCCTGGAATGTACGTGGACGTGTGGTGAAGACTTCTATCAGGGA
GAAGAAGGAGACCCAGACGGTCTTTCTCTCAGCGTATCCACGAGGTACCAATAGGGCTAGGTTAAGAAAATGGAATGTGAGAGCAGCGACCTCTGCTCGT
GATTTCAACGCATTTGGATGGAGACATCTTTTTGGAGACCCTAGTTCATCAGAAAAGTGCGCTCGACACCTTCAACAGACAACACATAGTCTTAACCCTT
TCGTGGTCAAACGCGGCAAAATGCCGCGTTTGACGTGTTTTGCAAAAGAGGGTGGAAAACAACCCCCTCAAACGCGGCATTTTGCCGCGTTCTATAAAAA
ACCCACATTGTTTTGTTTCTGCCAATCAAGCCTTCGGATAAATGTGGTTAGGTGCTACTTCTGCATGATTTTGGCTCGACTAATGAAACTAAATGGAGAA
TATTGTGGTACAGCGTATCGTTTTCGTCCACTTTGGTGTAATTATTGCGTTAAGCTTGTAGCTGCATGAAACGCAAGTGGGCACGCGTGTTGCGTTTCGC
ATGCTGACTTGATGGCTGGGCATCCAGGAGCCATCAATTGGGGTTGATATACACTATACTGAACTCAAGTGTCATACTAGCCTCCATTTATCATTCTGTT
TTGCTATGCGGACTAGCTTCACCGACGCACAAGACAAAAGAATCGTTGCGCTTGCGCCTGAGTACGAGTCCCAGCGAAAAGGAGTCAAATGGAAGGAGAT
TGCACACGCCATGCGGGGCAAGCATTCGGCCAAGGCGCTTGAGAGTCGACTGTGTGTGCTCAAGCGCACCTACGGAAGGGATCTTGCGCGGTTCCCACGC
TGTTTTTTCTCCACGGTGAGAGCAGCATCTCCTCACACGACCCTTTTTCATCCTCAAGCCCCGAGTCAAGCGGAAAGAACTGTCCGTGATGTTTTCAGCG
CTGTATCGGCAGTGGACGTTTGACAACAAGCTGGAAAGACCGATGAGAACGCAGGTGAGCTGCTGCCTGCAGCGGTTTCCAGTGTAATTCAAATGATTGG
GAACGTGCAACGAGATGACGTCTTCCCAGATGTTAGAGCTGGGTTGGGGAATGTTGCGGCTCAGTATGCGATCCAGACGAATGCGCGTCAGTGTTTGGGC
ATCGAAAAACGACCGGAGTTGGTCAGCAGAGGTGTCTTCGGCTTGCAAACACATGCGTCTCGAACGCTACTACTTCATAAAGTTATCCTTCGCCAGGGGA
ATGTCCTCGACACGCCTCTTTCGACGACACCACCTTTCCAAGACGCGTCAGTGATTTTCCTGAATGACTTCCTGTTCGATGAAGCAGCAAAGCTCGTCGT
TCAACGGGAGCTGAGCCTGATGCGAAGAGCGCGTTTGATTATATCTACATCTCGCTATTGCCCGCGTCATCGTGAATCCTGCCGAAGTAGTGGAAACTGA
CGGACACTACATACGGTCATGCAAGCTGGAAGTCCCCGCCGGTCCCGATCTACATGTACAAAATGCGGCAGTAGAACAAGACGGCGATGGACTGATGGTC
ATGGCGTTCATGTCGCCGCTATGGAAGAAGCGACGTCAACGAGGTGAACAAGGCGCTGCAGCTGCCAACCACGTACAT