Description :
From Genome Similarity Track
Location :
contig_47:121394- 127118
Transcript NameFunction/comments
g7828.t1hypothetical protein PHYSODRAFT_359933
g7829.t1conserved hypothetical protein

Sequence
5724 bases(100 bases per row)
ACGCCTTGGCGGTCGCAATCACTTCTGCTTAGACTCATCTTCCTGGCTATCGGGTTTTTCCTCCTTCTCGTCACCCTCCGCTTCTTCGTCCTCGTCCAGC
TCCACTTCTTCATCCTTGGCTGCCTCAGCCTCATTCAGCGGTGCATCGTCGCCCTTTTGCTCGAGAGCAGCGAGCTCCTCCGCACGCATGGGCGGCGCAA
TGAACCACGGCAGCTTTCCGCGCTGGTAGTCGTTGATCATTTGCACGGCCACATTGTTGTAATCGGGCTCTCCCTTCTGCAGAAGCTTACCGCACTTGTT
GGCAAGCTTCTCGAGGAAATCCCATTCATCCTTCCACTCCTCAATGCCGTACACCTTAATGAGGAACTCCTTCTTGACTCGCTGGAGAATGGTCAAAATG
AAGTCCGTCGGCTGAGGCAGACGCTCAGCACGAACGACACCCTTGAGCACCGTCTCAATCTCGTCATCACCCGTGTCGTACACGATGCCAGGGCAATCGA
TCAAGAAGATGCGACGCATGAGCGTAATGTACTGCCACACCTTGGTCTCACCCGGGATCGGGGCCACCTTGCACACCTTCTTCTTACGTAGTGCGTTAAT
AACCGAGCTCTTACCCACGTTCGGGTACCCAATAAGACCCACTGAGATCTGCTTTTTGTCCTGGTGCAGCTTGGCAAACTGACGCAGTAGGTTGATCAAC
GCACCCTTGCCGAACGGGTTGCTCATGGACGCGTGGAAAGCCAGCGTAGGCGTCGTCTCGCTGAGTTTCTGCACCCAACGCTTGGTAACCCAGTTGGGCA
CCAGGTCACACTTGTTAATGACAAAGATCAAGTGCTTGTGTGACGCGTTCTTGCGGATGTGGTTCTCCACGTGAGAACAACGTGTACCAGGCACGTTGCG
TGCGTCCAGAACCTGAATAACAACGTCGGAACAGTCCAGCACCTTGTAGAGCTCACCCCAAATGCGCTTGGACTGGCCCTTGTTGAACACGTCGTGCGAG
ACCTCCACCTTGAAATCCTGCTCCACCACAATGTTGCGATCGGGTCCCTTGGCCTCGTACTTTTCGGCGTTCTCTTGGGCCTTAGACAGCAGCGCCGCGT
AGTCCGTGGCTGCGACTTTAGCGCGCTTGCGGCTGCGCTTGCCGTTGAAGACCTCGTCGTAACTCTCGGTCTCCAGCAACTTCATGCGGCTCGTCTTCTC
GCTCTCCTGCAGCAGACCCATGGGCAGCTTGCGCGTGCGCAACACCACCGAGTAAGGGTCGGCAGCCTTGAGCGACATCTCGTTGCGGAACTTGTCCAGC
TCCTTCTGACCCACGACCCGCGTGTTGCCAAACCAGCGACGGTCCGGCTGCACGCGTCCGCTGGCACTCGTGATCTCCTGGCCGCCGACCTTGTTCTTCA
TCATGAGGGTGCCGCCGACGACCTTGCCGGCCTTGTTGCGGATGGCACCGCTGTTACGGTACATGTTGAGGCGCTTGATGGTGCTCTTGTCGCGCATGTT
GGCCGCCTTCTGCCGCTTGGGCATCTTGCGGTTGGGGTTGTCGGCCGACGCCTTGGTCGTGTTGAGGCCCTTCGCCATGGCTGCTGCGGTGTTCGACTAC
GGAGTTCGAGAACCGGGAGCGATTCCTCGGGCAGCGCAAATATCGGACAAGTACGCTACGGAGCTCTTCGCAGTCCGTTGGATCGATTGGTTGGACGCGT
CGACGCGCATTTTCATCCACTAAAAAGAAGTCAAGTAGATTTTCAGCCAATCCTCGATGAGATGTCCAATATTAGACACAACCTGACTGTTCTTTCACAA
ATTACAAATGTAGAACATGTACCGGATCAGGTCGCATGTCAGGTTTCATTCTTGAGCAGACGTGAGCCATGGCGACGATGGCGCTCGCGGTACAGCAGCA
GCAGCAGCGCGCGGAGATGGCGTCGTACCTGTACGAGAAGCACCTGACACCAGGACGGTGTGGCCGGTACGCTGAGCATCCGCCTCGTGGCCGCGCGCAA
CCTGCGTGCCGCCGCCTCCATGTTCTGGGTGCGCACATGCAACCCGTACGTGATCTTCCGCGTGGGCAAACAGAGCGTGCGCAGCTCCACGATCCCTGGC
AACGACAACCCGACGTGGCGCCGCGAGTTCCTCGAGGTGAAGCTGCCCAAGTTGCCCCTAAAGCGCCAACCGCTGGGCGAGCACTCGGACGTGCGGCTGG
AGCTCATCGTGGACGCCATGAACGAGGACTCGCTCACGGGAAAAGCCACGGAGGCTGTGGGCATGGCCAGCGGCTCGGTCATCGGCACGGCGTCCGTGGA
CTTGACGCCCCTCGTGGAGGGCAAGGAGGACGTCTTAGACCAGTGGGTCCCACTCAGCGGAGCGCTGCCAATGCCTGGCGCAGGTGGCGCAACGACAGGC
AAGAAACAGCAGCCGGAAGCTGATCTCAGCCTGGGGAAGTGCGTATGGTGCTACAATACGAGCCGCACGGAATGGAGCCACGAGTGGGCGACGTTGTCAA
GTTCGAGGGCTTTGGCTCGTACCCGTCCGCGGTGCTCGGCCCCGTGGAGGATTTGGAGCTCCATGTGAAGCGGACGAGCGGCAGCTATCTACTGTGCAGC
TACACGACCCCGTCGGGCTACGATGCGGCGCTGCGAGTGCACCGCAACAACGTGTTTGTGGTGCATCGCGGCAGTCTTTTTGACCGCTTCTACGAGTCGT
GCATCGTCGAGCCGCTCGAGTTCGTGGGCAGCACCCCCATCGGCCAGTCGGCCAAGGAAGTGCTGCGTCCGTATATGAACGTGGCCCGCGCTTTCAGTGG
CCCAGCGCTGATTGCAACGAAGGCCACGCTCATGACGACGTACCGCGCCTCTACAGCTGCAATTGGCGCTGTGGTGGCTTCGCTGGACGAGTAAGAGACG
GCAGTGAGCTGGGAAAGCGTGTAGGTATGAGGCTGGAGCCTTGCAGGCGTAGCACAGTTAGGAGTCAGTGGTAAGTATGAGCCTGCTTTTATTAATAGGA
GGACAATCTGGAGGACAATATGTGCATCATGATTGGCAGATGTAGCCATCTCAGACTTGAAGACACCTCGCCAAGGACGTCGACAAGGTCTCTGGGGCTC
TGGGACAATGCAAGTGCCTGCCACCGCTTCTCCACATACGAATCGGAGCCGCATCAGCGTTGATGGCGTCATCTCGCGAGAGTCTGGACGACTTCCGGTC
ACCCTCAGACACGAAGAGCTACCGACTGCTCACTCTGGCAACGGACTGGAAGTTGTGCTCGTCCAGAGCGATGCAGGACGAAGTTCTCGAGTAGATGCCA
CTAGCAACGACGATGACATAGCCCGGGGCAGTCTCAGCTCAACTGACGACACAGATGCTGACAGTGGAGACGAAGGGAAGGAAGAAAACGACCAAGAAGA
GACCAACGATCGAGCTCCACCACAGGCAGCGGCGTGTTTAGCTGTGAATGTGGGCAGTCTAGCAGATCCGGAAGCGCTGCCGGGTCTAGCGCACTATCTC
GAGCACATGGTCTTCATGGGCAGTAACAAGTATCCCACTGAAGACGCGTTTGAAGCTTTCCTTAGTGCTCACGGCGGCTCCAGCAATGGAGCGACCGAGT
GCGAGTCGACACGGTTTGTCTTCGATGTGGACGCTGGCTACCTCGAGCCGGCGCTGGAAATGTTTGCGAGTCTGTTTCTAGCTCCGTTGCTTCGACGAGA
AGCGATGGATCGAGAGCTGAAAGCGGTGGAATCTGAGTTCCAACGTGTCCGAAACAATAATCCGGTTCGTGTGCAGCAGGTCATGTGTGAGACGAGTGTC
CAAGGACATCCGTACTCTCGCTGTTTTACGTGGGGAAATGTGGAGAGCTTAAAGTACAGTCCAGAGCGTGATGGTGTTGACGTTCGTGAGCAAATGGTGG
AATTTTTCAGCAAGCACTACGTAGCGCCGGCCATGAAGCTTTGTGTTTATGGATGTGAACCTCTTGATGTACTGGAGCAGTATGTGACCCAAAGCTTTAG
CGCTATCCCACACAGCCGTAACAACTACGAAGCATCAAAGCATGAGCAGCTACCGGAGCCGTACGGATGTGGAGCAGGCCAGCGACCAAGCATTTTACGC
GTCATTCCTGTAGGTGAGAAGCGCTCTATGCGCTTGTACTGGATGCTCCCAGCGATGATGGAGAAGTATCGGCAGAAGCCTTGGTATTACGTAGGTCACT
TGTTGGGTCACGAAGGCCCAGACTCAACAGCATCGGTTCTCAAGCGCCGAAAGTGGGCTACCGACCTTATCGCTGGGACGTCGGATCGAGATGCTTACGA
ATTTGGTTCCTTTGGCACTGTGTTCGAGGTTCGAGTAGCTCTCACGAAAGAAGGTCTGGCTTGTTGGGAACAGGTTGTGCAGCTTGTATTTGATGCTCTG
CAACTCTTCTCTGCTAAGGCAGCAGAGGATGGTTTGCCCGATTGGCCTTATGAGGAGCTCCGCTCGTCCAGTGAAATGGATTTTCGATTCCAGGAAGATG
CCAAAGCACCAGTGTCACTTTGTCGCGAGCTTAGTGAGCGAATGCTTCCACGTCACCATGTACTGCAAACGTGCCAAGGAGATCTACTGCGTTACGATCT
GATTCAGGGTGTATTCGACAATTCGTCCGTGTCTGCCTTCCTGGCTGGGCTTTCTGCTGATAACGTTCGTGTCGTTCTGTTGGCGTCCTCATTTGGTGGC
GATTTTAACTCGGAAGAACTCCGGACTGAACGATGGTTTGGCACCAAGTACACCGTGAATCGAATACCTGATGTTGTGCTTGCTGCTTGGTCGCAGAGCT
CGGGGGAATTTGCAGGGGTTTCGCCATTGCCAGCACCTAATCCTTTTATGCCTCGGGACTTCTCAGTGCTGCCTTGTGAACCGGCCACTCAAAATGACAG
CAACATCCCTCCAGACCTCATTCTCACCACTACAGCAGCGCAACTATGGTACAAGCGTGATCGCACCTTCTTGGTTCCCAAAGCCAGCGTGAGCTTTTCG
TGACACTTCCCGCTTCAACTGCAGTGAATTACATGCTTGCTGAGCTGCATGTCGAAGTAGTCCGCCATCGATTACAGCACACACTGGAGCAAGCTGGCGC
TGCAAGCTTTGACGTTGAGTTGGATGTTCGAGACGAGGCTATAGAGGTTGTGATTTCAGGTTTCAGCGACTCATTGCCAGCGCTCGTTCGATCCATCATG
CAAGAGGTTTTGAGTCCACCAATAGCGTCCGAGGTTGTATCGGAGTTGACACTTGCTCGGATTGAGCTTGAGCGAGAGTACCGCAATGCAACGCTATCTC
CTCGAGAGAAAGCGTATGAATTACGTCTTCAAATGCTTGAAAGCAGAGCCGTTTCCACGGATGACAAGTTGGAGGCACTTCAAAGCAAATATGGTCGTGA
AAAAGAGCTTGCAGCTGACCTCGCACATTTCACGGCCACTGTTCTCGGGCGAAACGAAGGTGTTCCAGCGACACGATGCCTAGTGATCGGGAACATGAGT
CGAGATGCTGCCATAACACTGGTGCTAGACGTTGAAGCCGTCATGGCTGGAAATACTGTTTCTCCTCTGGCTTACGAACCGGACTTGGAGCTTGAACCTG
AACCTCCCCTTTTGGTTCCACGTTGCCACACGATCGCTCTGCCGTCTACGACGAATGGTTTGCTTTTGCGTCGTCAAAGTGAGCGAGTCGGCGAGCGCAA
TTCAGTGGTAGAGGTGTATTTCCA