Description :
From Genome Similarity Track
Location :
Scaffold_90:121313- 126598
Transcript NameFunction/comments
Phyin_T30-4PITG_19205Putative uncharacterized protein

Sequence
5285 bases(100 bases per row)
AGCGAAGCTACATATAATAGATATATACTGTGATCTACTTATGTTACGGTTCAAACCAACACTGCACACAATATTCTTAGTACTCACGTGCTATGATAGA
CTTGATCACGGCTTAACGTGATCTGCAAGATGAGAACTATCTTACCCGAGAAGGTTCTGTCTGTATCTCGTTTTAGCGCATTGCTCCAAAAATAACACGA
ATCGGAGGCGCGCGTGGTTGCAAAGCTAATATATGCTGTAAGGAAGACGGGTCAGTATCAATGATGCTACGAAATATGCGTAGATCAGTGAGGAATCCCA
GTGTAGCTGGAGTAAATACGCCTACTCAAACATATTACCCATCTGCTCGTCGTCGCCGTGAGGCAGTCGCCACATATCATCGATTGCGACGGTCTAATAG
AGCAATGTTAATCAGCTCCTCGCGCGAAGTATCTTTTAGGATAGGTAGTATTTGCCGATGGTCACCACAAACATCAATATTATGCTTTGAAATTATTTTG
CTGAGCTGTTTGTGATGTTACTGAAGGTTATTTCCACTATCTTCCGCATGCATGTATCTTACTTGCATAGCTGACTTTCTTTCTGACTTATTTGCACAGC
TACTGACTGACAGAGTGGCGTAAATTCTTTCCGACTGACATTATACTGGGTCCGATATGTACGACAAACATACGAAGATATATGGCTGTAGGCAGAGTAT
CAGATCGTAATGATGGTTAGACTTGAATTGAATAATAGTTCATGTACATTAGATGGAGTACTTTCGCTGCCTACTTATCAGCTCGGCGTGCTATTTGATG
TGTCCGTGCATATATCGCAAGGTCGTTATTGAGTGTATTTGCCACGCGCTCGTGATAGTTCAACCTATGCATGGGTCACTGTTTCTTTATCGGTACTTTT
GCATCGTGGTGCTAGCTTTCGGCGCCTACGCTTCTGATGGATCAGCCTATATGGCCAAGCGCGCCACTAACTGGACGTAGGTCATAACCGCGGTGATACA
GACAGGCTGACCGCGCGTATGTAGGTAGTGGTCAACGCGAAATATGCGCGCGGTGGGTACACCTTATAATCATTCGCGACTCAACCGGACTCTCGTCTTC
ACCATTATACACAGGAAACTAAAATACAGTACTGCGTACAGGCACATCGACTTGCGACGACCACCTGTGTGGTCAACACTACCATAGACGTGCTTGTGTC
TATGAAGACGGCAGCTTATTCGTCGGGGGCATAGTGCTCACTCTATACTGAAGCTTACATTCGTGAGCGCACATTTATGAAATATACGCTGTGAGCGCTG
ATGGTACAGATAGCATGGTTTTGCGTATGCCCACGTGAGCGAGTGTACGTGCCATCTACGGTGACGCGTAGGCGGATAGGAACCACCAGCTTGCAGTGGT
GCACAGCTGATTCCATGTGCTAATTACTTTATGAAGCGCGCTACGCTCTGTAGGTGCGTTAACACCATTGTCAGCTTACCGTATGTGCGGCCCCAAGCCT
CGAACCGTCAGCCAGTATACCAAAAACAAAAATAGGTAGGAAAATGGGATCATAAAAGGGTATATTTACCATTAGTTGTTCTTCTGCTGCTTCTTTTGCT
CGATGTACTTGGCGTTTCGGGCGGTCAGCTTGCGAGGGCGGCTGTGCCTCTTTTTCTTCTTGGGTACCAGTCAGGACCCATCGCCTTCTTGACGTTTGAC
AGGCTTTCCTGGCGGCGTACTTCGGTTGAATCAGGTGGTGGGGCTTTTCCTCCCAGAACTCAACCGCCTTTGGGCCGTTCTCGCAGGCAATACAGCGCCG
CACGATGTCCCGCCCGCTGATTGTACGGAACGCGTAGCCGTAATGCAGCTTCCCGCAACCGACGCAGCGCGCCCGGGTATCCGTCGTAGACCGCTTCGGG
TTCAGCAGAAGCGGGTCAATCTTCGCCTCGCATTGCTTGCACGTAGGGCCCACCATTTTGCAAACTGTGAGTATGTTAGCAAATTATATTGTTTTAACCA
ATTACTTGCGTCCAAATTTTATTTAAGTGATCAATTATTGGCAATACTTTATTGCAGTACCGAATAGCTCATAAATATTTTAAAACAAATGGGCTCGAGA
AAAAGGCTGGGTCAGTTCATATTGTCCTTGGAAGCAGGAAAAATGCATCCTGCAGCAGTGTAGACACTTCCACAATGTTGGCGCCCAATAGAACACACTT
CAGAGTAGGAGAACCAGACACATACTTTAAAAGCATTCGCGGTTATCGACAAGATCTTATTGCATATTTTTTACTCGACAAGCATCAGTTTCTAGCGGTT
ACTTGCAGGTGATCCAACATTTACTCGAAACTAATCTTTTCCCGTACACAATCTCCGTTTTGTTGAAGCGGCGCCCCTCGAGGATCAGACAACATGGAGA
CATCGAGCACAAGCGGGGCGTTCACCGTCTCGCTGCACTCGCTAACGTGGTATCCTGGTGGTGCCGATGAGGAGACAGCAGAGCGTCAGATTTGGGGACT
TGTGCAGCTCGTGTCGCCCCCGGAGCAGCCTGTCGAGAGCTTTTGGTTTGGCGCGGAGAACCCTAATATGATGACCAGGAGCTTATCGATTTCAACACGG
AGCAGCAACCAGCCGCTGCAACTTGACTACAACCAGGGATCTAGGGCCGTTCCACTCACGATTAATGCTATGCAGGAACTGGTGCAGACGCAGCTGCTAC
TGTCGCTTTACTCTGGTGTGTCCAGAGCTCGTTCAGTGGATTATCTGTTGAGCAAGACACTCGTGCCATTAAGAACGCCACTGCTAGGAGGGAGAAAGAG
GCAAGAAGTGGAGTTCGTGTCGTCTGGAGAGAATTTTGTGGTGGATCTCGACGTCCAATGTGACGTGGCGCTGGCTGACGTTTTGCTGGGCGCGAGGATA
CTGGGGCTTCATTCGCCTCAGATATTGAATTTGCCAGATGAATGGGCAGCTCCAGGATGCATAAGCAATGAAGAGGCGATTGCGTTTTGTGCATCACAGC
AGAACACGGCTTCCTACGAGCTGAAGATTGCATTGCCACGTCTGGGAGAGACAGATAACGGTGTAAATGGTAGCGGTGGAGAGGGAGGAACGATGTCGCC
GTATAGATTTGATGCTACAACATTGAAGGGAGGGAAACTACATTTTGAACCCCGAGTGCAGGTTCAAAGTGTGTTTTCAGGGTCGGAGCAGTACATGGTG
GTGGAAGAAAGTGTTAAGCCGATAGCAACAGATGGCGAACAGCAAGAAGAGCGATCAGCTACACCCGATTCAAGTTTAACAGGGAAGTGGAGTGTCCAAT
TTCCCTCAACGGCTGAAGTATCTGTACTATATTTCAAGGTAAGGAAGCGTGTGTCTTGCATATTAATCATTTTGTTTTGGCTGTAACATAGGCAGCTGAA
CTAATATGAATTTTCCTTCTTAGAGCTCCGTCGAACGTTTAATTGAGTTTCTTGTGGTGGAGAAACACCTGAATGGAACATTACGAAGAAATTCTGTCGA
AAACTCGAGCGGAAAAGCAATAGATGCCATTTCAAGTGAAATAAGTTTGTATCTGCACGAGCTTCTCGCGCCCGGTACCACTCAAATCGTGCCAAGGGCT
CCATTACGAACCCTGTTACCTGTTACACGAGCCTTCCTGGAGCAAGAGCTGGCAGTAGCGCCGTCGAATGAGGACAAAAAGAGGTTCCAGGCAGCGTTAG
CTGACTACGATACGACTATGCAGAAGGCATTATCTCTTACCAACGCAGCGATAACCGCCGGAACTCACGTCGAAATCGTGGCGGAGATATTGCATACACC
ACTGGTTTTACAGCCACCTCAAGGTCTGGAGTCGCCTTCGAAATCAATAACGCCGCTCATTGCCCCGCGCGATTTGGAAGCTGAGGGTGAAGAACGTCGC
GACATTTATGGGGATCTTCGTACAGAAATCCGTTTGGTGGCGGCAAGTCTTTTGCGCGAGTACACGGAGGCGTTCCACAATGGAGACGGAAGACAAGGAA
TAGATGACTATGCAGCTGATGCTCCAACTCTACGTGATGATAAGAAGCAGACTCTCATCTACCGACTAAATACTCAAGGTGCGTATCACTCACTCAAACA
ATCACTCAAGAAGCGGATTGTGCCTGTCATACGCGAAACATTTTCTCGTGGTGAAGTCACATTTGAAGGAAATGAAGAGGACGGACAAATTCAACTGGAC
GAGAAAACCGTGGAGGAAAAGAAGAAGGCACGATTCGGCCAGCTGTACGCTCTTCTCATGCGAGAAGTTAATGCAGTTTTGAATGAAACGTTCTATTCAG
ATTCGAACGCGCTGATGGAGAAGACATACGCGACAACTGAGGGGCGACCAACACCAAACGAAATCGAGGCTGTGTTAGAGATGTTGCGGCTGAAAACTGT
GGAGAACGAGGTTATTGGCGATTTCGAGAAAAGCGAGATGCTGCATTTGGACCGTATTGCGTACGCAGAGCAGCATGCGGCTCATGTCCATATACACCCG
AAGAGTCACGAGCAGGTTGATGTGGGTGCGGCATCCGCATCTCAATTACTGATGAATGTTTGGTACGACTACGCACGCTTCTGTATTGCTCAGACACGAC
TTGAAAAGGCAGGGGCAGCTTTACAGCAGTGCTTGCGTCTCGATTCTCCCGCTATTCGACCGTTGCTTGCTCTCGTAGCCGTCCAGTGTGAGCTGCGCGA
CTTTGTGCGCGCCGAGTCTTTCGTAAAGAATGCTGTGATTGAGGCAGAGGCCAGTGCTCAATCAGGCGACGGGGCTAGTGCTGGGTGTAGTGCACTGGCT
CACGCTTTATTTGCGTATGTTTTCTCACAATTCGAAGGAAAAGACCCGACTGGAAATTATACGCTGTTCGAGCTGCTCAAAGCACAGAAAATGCTTCAGA
TCAGTATAGGCAACGTTAAGCAGCGAGACATTTCGTGCGTGAGTGCAGTCTGGATAATTCTAGCGGAGTACGCTCATGAGTGCAGGCTGTGGGGGGTCAC
GCAACAAGCGTTGCAACTAGCTGATAGTAATTTGAAATCTCGTGATATAGTTTGTGCTGAGTTACGAGTCATGAAACGAGCAATGGAAGCCGATCTGTGT
CTGATAGATGGTGTTGCTGGTGAGGGCGCTGCTTCTCGGGCGATCAAGCTGCTGCAGGAGGCCTTAGAAGTCGATGCATCTCATCCTGTTGCATGGTTCA
CTCTGGGGACAGTGTATCTCCGACAAGATTCTCAAACCAAGACAGCAATAGAGTGCCTGCTGCGAGCACTGGAGCACCGTGGAAC