Description :
From Genome Similarity Track
Location :
Scaffold_47:121306- 123926
Transcript NameFunction/comments
Phyci_225928Hypothetical protein

Sequence
2620 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNatagcactttgaacactgagaccgaatggctggtggcagcctataattagctggtcaacatggaattttaactaca
gacatctggtgtcaatgcattgttttcattggctaaaataaaaattcgcttaggacaaaacttcgcttaggacaggggcgatgcggtaCAGTATAGAAAT
TACTTCATCAGTACGGAATATGTGAGCAGCATCATCCGTCCCGTAATCCTATCGATTATTATAGCCGATTTTTCCCCCAGAAATCTTACAACCTCATTCT
ACGATTTACACCAAGCCGAGCACACACACCCCTCGTTCTCGCAAATCTATCCAAATAACATGGATACTAGCGATACCAGCGCGCTCCGTCCACCGAACAT
CGATCAACTTAGTGACAATGTCATCTGCAGTGTTGTAACCCACGCCAAGCATAGAAGAAGTATCCTCGTCACGGATACAAGTTTTGAACAGTGCGATCTC
GAGGAGAATTTCAGCCTTGCCGCCGTGACTCGAAATGAATCAATAGTGGAATCTGCCATCTGTTCTCCTACAATTCGAGGAATGTTAAGCGCTTCCTGCA
ACAAGTGCCCCGAGACTGGCGCAAAGTGTGAGGCCATGACACTACCAAAACGCAAGCCAACAGACAGTGGAAACAAGTGCGCGGAACTCAAACAACTTCT
GCTTCTAGGAGAAAAGATCCAACGGCAAAGATGGCGAGACGACAAGAGGAGATACCGCAAGAACAAGGGCGACCACGCCAAATGCCTTGAGAATACCATA
AAACGTCTCCGCCAAGTCGTCGAACAGCTGGGACAAAGGCGCCGTGTTCTCTGCTCAAATCATAGCGCGTGGAGTGTGGCGGTTGAGTACTTCAGGTTGT
TCCGCTACGGCCTTCAATCGAATCCTTCGAATTCGGACACCACAAAAACAAAGCCGCTAAGTGATCACCTGATCCATTTGCGCTCGGCCATGACACCAGA
CGTGATTTTCAATTCTGGGCGAGGCGAAGGTTACATAGTGCAGAGTTGGTGGTGTTTATCACAGTGGTTCGCAGACATCGTGGTCGACCTTGACGAGCTA
CAAAATGCTGGCGGAGGGGCCGTCCTCGCTACCATCACAATCAGCTTCACTATTACGGAACGCACATTTCGGGGAGTATTCCCGCACGTCCGTGATGGAG
AAAAGTCCATCTATGGACCCAGGCTACTAAACCAGGGAATCACCCTGCGCGGCTGGACGCGCTTCGAGTGGGACAGCGGCTACCATCGTGTGACAAGCAT
CACTGCCGAGGCAGATTTCCTATCACCGATATTAGCCCTCGTAGGCAGCCTGGATAAGGTATCCCGCTTGTTTGAGAAGTCCCTGGTATCCCCAGCGTTT
CATCGCCATAATGGGATCAAGTGATCGGAAGAAAAAAATGAAGACTAGCTACCGGTTCCCTGCACGCGGAAAACGTTTAAGCAGAGCAAGAATACAAAAC
ATGCTTCAAACCCCCCAACAAGGACGCCGAAGCACTCCAGATGCAATCTTGAGTGGTCCGGTAGTTTATCGGTTGATGTGTTGGCGCCCGTGGCGTCCAA
CTTGGCGCCTGAATTCATTTCCCCTCGGGCAAGGAAAACCGCCGCGGGGATCCTGCCCAAAACGCCGACAGCGACAGTGAATCTGGCGCCAGATTCACCC
CGCGTTTGACTCCATGAGCCATCGTTCTTGGCATGAACTTCTTGCATTACCACCGCGTTATCACGGGGCATAATGGGTTGGTCTGGACAATATACACGCG
CTGGAGACACCATCACCCAGCACGAACGTGCGAGCGTCTGCCAGCCAACCATCGGAGACCAGGAGCGGCCGACCAACAGTCCAGTCGATAGCTGCAGTCT
GCAGGCAGTGTTGGTCTCCGTTAAACCGGCACTTCAACGTGAGCGACTGCGCGCCGTTTCTATCCGCGCCGCACTCGGTTTTTGTATGTAGAGCAGCGAA
ATGCCGCTTGGCGGTTCTAGATTTCCGCACGGAGAAAAGAGAACGAGAACACAATGCATTGGGCAGGAAAAAACAACCAACAACCAAGCCTTACTCAGCT
CGTGCTGCTGCAGCAGTTGC