Description :
From Genome Similarity Track
Location :
Scaffold_217:1213- 15985
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_217-snap-gene-0.18Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.7Cysteine protease family C01A
Pytir_DAOMBR486maker-pir_contig_217-snap-gene-0.20Cysteine protease family C01A
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.1Mitochondrial Carrier (MC) Family
Pytir_DAOMBR486maker-pir_contig_217-snap-gene-0.21Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.2Flagellar protein

Sequence
14772 bases(100 bases per row)
GCCCACGAGGCCGCGACCCGTGCCCGGCGCGATCTCCGTGAAGCCGAGCCAGACGTACTGCAGCCAGGCGTCGAAGGCCTCATTCGCGGACACGGGCACA
AGCACGGAGGTAACGACCTCCTGGCCGTCGTTCTCAGAGTACTCCTCGAACGCGCGCGGGTCCGCGTACCGCTGGGACGATGACGACGCGCTCATGCTCA
ATTTGTTGCTGCTGTTGTGTGTGCGGGCGTGTTGGCTTGTGAAGGAAGTTGTTTGTTTGCTGGCAAGGAATGGATTCAATTTGGTTGTTGACCATTTCGT
CAACAGCAAATGCACCAATCATGATGACGCCCGCATTCTCGACACAGATTTGGCCAATGAAACTTGTGATCGCAAGTATTTTAGCTAATCAGGAGAATGC
AAGCACAAACTAATGTTGTAACTTGCAACTTGTGAATGAGTGAGCTGGTTCTGGCAACTTGGAGGTCTGGATGAGAAAGTTAGTGCTCTCTCTCATGAAC
TTGCTCGTTGGTCGGCATTCATTAGCCCAGCCATTCCCATCCATTCTCAAGTGAAAAACACAAGCAGCTTTTGTCCATATATTATCCTTTTATTTCAACA
TTTTCATTCGTACGCGGCGTTCCCTCTTTCTCTCAGTTCATCTCTCCACAGCAATGGTAGTTGCTCACTGCTGTGGTTGACCGTTCGCGAGATGCTCGGC
GCGGCGACGGCGCGCGATCACGAGCCCCACCGCCGTGAGCACGATCGTGCCGATGGTCACGACGGACGCGATAGCGATCCACATCGTGGGCGACAGGTAC
AGGAACACCTTATCACCGCCGCCGTCGATCGTGGTCTTCGCAGTGCCGGCCTTCGCGCCGAGCGGGATCACTGGGAACACGTTCACGCCGCAGTTGATCT
TCGAGTCCATCTTGAGCTTGAAGTAGCCCTTGTCGCCCCACTGGGACGAGTACGAGTTCTTCAAGATCCAGTAGTCCGTCGAGCCGTCGCTACCGTATCC
GACCAGCACGACAGCGTGGTCGATCTGCGAGCTGTCCGTGAAGTCACCGCTGTTCGGGCACTCATAGATGCCCCCCTTGTAGTCCTTGAAGTTGCTGCCC
GAGTTAATCGCGACCGAGATCGGCTGGGTCTGCAGCGCGATCTTCAGCAGCACGGTCGGGTCGGTCGAGTTGTCACACTTCTTGCCAACAGCCTGCTCCC
AGTTCTCGATGCTGGCGGCGGCCTTGCTAGGGTTGCTCTCGCACGTCGCGTTGCCTGTCGCTGTCGGCGCCTTGGTCTGGGTCTTGAACGGGTTCAAGGT
CACCTGGTCCACTTCCTTGTACGGCAGGTCGAGCTCGCTCATGAGGTTGAGGCGCAAGCCCGCCGCGTCGGCGAACGCCGCGTGGGTCATGCCACCGTCG
CAGCCGTTGTTTTGCGAGCCCCACTTCATCTCGGTTTGCAGCCACTTGGCGCCCGTAACACCATTCGCGGCCCAACAGTACTGGAACGTCGCGGTCATCT
CGCGCTTGCTGCAGTCCAGGAACTGCTGCGGCGAGAGCGGCTGCGGATCATTCTTCGAGTTGACGACGACCGCGGTCTCGATCGCATCCGTGGCGGCGAA
CGCCCAGCAACTGCCGCACTTGTTCTGGCTCTTGACGGTCGTGCAGATGTTCTTGCCCATCGGATTGTCGGTTGAACACCAGTTGAGCGTCTTTGGCAGC
GACGTATCAAGTCGACGCGTCGCCTTCGACGTCTGCTTCATCTCCGCTTCTTCGAGGCGGCGGCGCGTCTGCGCGTGCAGCTCCTGGCGCACAAACTCCT
GCGCGGTCTGCTTCCGCTCCTCGTCCAGGTAGAGGTGGCGCGCGTTCACGCCGACCTTGTACGAGAAGTCGACGCCCTCAATCGCGGCGTGGGTGCGCAC
GTCCTCGAGGTACTGCATGTGCTCCTGTAGACGACGCATCTCGTCAACGTCTTCCTGCGCGTCCAGTCCCTCACTCTTCATCATCTGACGCACGACCTCG
GCGCGGCTGACAGCGTTGCCCTCGCCATCGGCCCAGAGACAACGCGCGCCGTTCTCGCAGTGGAGCAGCGTGCCGAACGACACAGGCTCCGGGCCTGAGG
CATTAACGACGCCGAGCGCGACGGCGGACGCGAGGAGCGCGAACGTGCGCATGATAGAAGGAGCCTGCATGCCGTACGTAGCACCTATCTACACCGAGTG
AGAGAGAGGTGTAGCTGGTCGGTCTCCTAATAGAAAAATGCCTTCAACACACGCGGGACGACCGGTTGTATCTGGCGAAGCGAGAATAATGAGTCCGCCC
CCGCCTTGCGCTTGCTTGGCGCGCTCTCTCTATTGATGGTGGCGCACTTGGGTAAGTGGAAGTGTGTAGAGAGAGGAGCGCGGGGTTTTATATGGGAATT
TATATGGGAAACGTCTGATTGCGTCGCCCACCCGCGTATTGAACCGAACACTTGCTTTTTGCAATTGGTCTTTCCCCCTCATCATCCCTTGCGACTCGCT
CCCCGCGTCACTATTGCGGGGATTTTGTTGCAAATGGCTCTCTTCAAATGAGTAATTGAATTATATAGGATCAGCTTTAACATTTATAGTATGAAGATGA
AGGATAATATGTCATTAATAGAGGCTAATACATGAAAGCAGCTGCTGAATCAGACAAAAAGTGATGGAAGAACTGACGTTCCGTTTTTGTGTCACCCCAA
AAACTGACTTGATTTGCGGATTTTTCTGGTTGTAAAAGGCAGCCTGCAAAACAGTATTTGGCACATTTGTAAATTCATACTTGATAAAAGTCTATTTTGC
AGCGTGATAAATACTTTTGGATAGAGGCAGTCGAAACATATTGCGCTGTGCCTTCCTCCAATTGAAGGATTCCAAATGCTCCCAAGAGCTTCATTTTCGA
TGATGGAACGCTGCGATGCGAATATGCTCGAAGAGTAGCCACCAGCGTCAAGAACACCACAGCACAATCTCGCAAACGCCAGCACGAAGAGCTCTTCCAA
GATGGCACTACCACATGACCACCCTCGTCAATTTTGGGAAAATATACAATCGTTTGTTTGGGCTTATATGGCTAGTTTCGCTTGTTTCATCTCAATATAA
ATCTACAACTTTTCTTTCTCTTGTTGGTCTGCTCGTCGCCACTGCGTACAAGGGGCCTGCTCCGGCTCATGTCAATCGCCTCATGGATCACGATCGAACA
CCAGTCAGGTAAGTATCTCGTCGCCACTGCGTAGCTACAGCTCAGCTCAGCTGTTAACTAGCGACTTTGAGGATCTCTGCTGCTACTGTGGATCTGGAGA
ATTGCAGTGCGACATGACTCTTGCGGCTTCAGACATCCGGTCTCTGATGCTGCGACAGTGTTGAAAATGGCTAACCTAGCTAACTGATACGCGCTGGCGC
TGGCACAATTCCCTCTTCGCTTATACGAATTCTCTTCTTCTAATCGTGCACGACGGGCGTCTGAGCCAAGTAGATCGAGGCGCCACTCACCTGTTCGCGC
AGCACCGCGCGCTTCTTCTTCGCCCAGAAGAGACCCACGCCCGTGAGCACGATCGTGAGAATCGACACGATCACCGCGAGCGCGATCCACGTCGACGGAC
TCATCCCGACAAACACCTTGTCGCCGCCACCGTCCACCACTGCAGTCGCAACACCAGCCTTCGCGCCCACAGGTACCACGGGAAAGATGTTGAGTCCGCA
GTTCGCCTTCTTGTCCGCGACGAGCTTCAGGAACCCCTTATCGCCCCAGGAGCTACCGTATGAGTTCTTCAAGATCCAGTAATCCCCCACAGTCGCGTCC
GTGCCGTACCCTACCAGCAGCAGCGCGTGGTTCACATCGTCCTTCGATGCGAGGTCGCCGTCGTTCGGGCAGCTGTAAAACCCGCCCTTGTAGTCCTTGA
ACGGATCGTCCGAGTTGAGCGCCACGGCGATCGGCTGTTCCTGCAACGCGGTTCGCAACAGCACGCTCGGGTCGCTGCTCGCCGAGCAGTCCTTGCCGAC
AACCTGTTTCCAGTCCGAGATGCTCGCCGCAGTCTGGTTCGACGTCCGGATGCACGTCGTGTTACTGGACGCGGATTGGTCGTTGTATGGCATCACCAGC
TCAGTCACGAGCCCGTACTGCAGCTGCGCTGCGTCCATGAACGCGCCGTGGGTCATGCCGCCGTCACAGCCGTTGTTCGTGGACTTCCACTTGATCGTCT
CGCTGAGCCACGACACGCCACTGACACCTCCAGACGCCCAGCAGTAAGTGAACGACTGCTCGGTCTCGCGCGTACTGCACGACAGGAACTGCTGGGGCGC
GAGCGCGACCGCCGCGGTTTGGTTCGCAGCGATCGCCACCGCTGTCTCGATCGCATCTGTGGCGGCAAACGCCCAGCAGCTACCGCAGTTCTGCTGACTC
TTCACGGCCGAACAGACGCTGTGATTGTGCGGGTTCGCTGTTGTACACCAGTTGAAGTCGCTCGTGCTTGTGGTGCTCGAACTCGACGAGCCCGTGGCCA
TTGTCGACAGCTGCCGCACTGACGACACTTTGGGTCCAGCGCGCATTTCCATGTGGACAAAAGCCTCGGGCAAGTGCTTTCGGGGCGTTGTGTCGAACAA
ATGGCGCCCATTCACACCCATCTTGTACGTGAACGCATGACCCACGCTCTGCGCATAGCGGTGGACATCTACACATGCAAAATAAATCAGCCAGTTAGCA
CATTGTACACTCAGCCCACCCTCACAGGCAAACGAAACAAGACGCACTCTCGATATACTCCATGTGGCGCTGCAGGTTGCGCAGCGGAGCCTCGGCGTCG
CGCTCGTCCACGTTGTTTTGCGCGAGCAGCAATCTGCGCAGCGCCTGTGCGTCGATCACCTGGTCGTTCTCGCCCGTCCACAGGCATGAGGCGTCGCCCC
CGTGTGGACAGCTCACCAGCGTGCCGACCGAGTTGTCTGCGGCCGTGGCGATGTCCATTGCGGCAGCAAATACGCCGAGCGTAGCGAATGAAGTCACGCG
CATCTTGTGTCGCAAGAGCTGATGTGATTAGAGGGCGGATGGAAGAATGAACGAGTGAGCGGGCGTCGAAGTCGCGCGTGAGTATGATCTGTTCTCTGCT
TCTCGTGCTTCTTGCTGTTTGTTGCTTGCTGCACAGACAAAGGAGTCCTATAACTGTGATATTTCTGTTTACTTTTTGGTACAAAATGGTACAAAATGAG
AGTCACACGGTTTGCAAAATTTAGCCAGTGTTTCCCTTCCCCTTTCTCATCGCCAAGTTTTTACTGTTTTATGTGGTGGTACCATAAAATGAAAAATTGA
TCTTTATAAGGATAATATTATATTTTGTAGGACTATTGGAAAGAATAATGGGTTCAGCTAAGAAATGGCATAGCCAATAAATAGAGGATATTATTATTAT
AAATAAAGTTTCATTGACTGAGGGTGTTGAAAATCTTGTCACCAGGTGCACAGCTGCACCAACCTGGTTCTGTATATTTGCATGGATGGGCTCATTGCAT
TTTGAAGCGACTAATCAAAATTATCTTTGACACTCGCATAAGCCTCACCTATTTCATAACCTTTGCATTCGCATATAGTGGCTTCGTCCTGCTATTCCAC
ATTGCCTCCAGGCTGGGAGTGAAATGGAAGGGATTGCGCCTGAGAAAGGTGCGAGCGATCGAAATCCTGCCGATCATGTCTCCATTTGCATCATTTTCAC
GTTGGGTGGACTGCTCCGACTTGCTTGCAACACGAAGGCGGAGCCGAGAGGTTCGTCCCATTGTCTTCGCCGCCAGTATTCGGGTCACAAGATTTGTCAC
GAGCTGCGCTGTCCACTATGAAGCGATCCAATGGTGCCCATGCTCACTTTCACATCTCATCGTTATGAGAAGACAAAACAATCGAACGGTGGGCTCCATG
GACCTCCTCACAGATGGATATCCGTCCAACCACACAGTGCAGCCAGCAGCCACATGAACCACTCGGTCACTCTCGAACCCATCCATCCGCATATCTGTCC
AAGCCACCAGTTGCGAGTACAGACAGCTCCAAGTACGAACTTGGTGGGGAAATGGTCGAATACACCTGAAGGCCCCAATCTGAAAATGGCGATGCTGGCA
GTGGTGAAGGAATCTTTCAGGTTGGGTTGGGGTGACTTCAAGACGTCTGCGTGGCTCGTATAACGCAATCCCAGCTGCCATTTCGCGATTCAATTCATCC
AGTTCGCCGCCCATCTCTTACAGACGAAAACCGTCTCGATTGATCATAATCGATGACCAGCAGCCTAAAAAAACGAGGCAAAATTGAATCTCCCCACAGC
ACGAGCTGTGAACATGTTTCATCCAGGCATTGAGCCTCATTCTCCATTACGCATTTAGAGTCTATTTCCAGCCATCTCGATGCTCTTTTCGAAAGGTGAT
GAACGCATTCGCGCATGTTGCAGCTCGTGGCTCATGGTGTTGAAGTTGAGCCAAGACCGCCACGACCAAAAGACCAAATCATGAACGGACGAACGCGTCA
ACTTTAGGCAGTTTTGTATGGGAACTCAAACCCATGTTGTCTTCTTCTATTTGGCTCAGACTGACGCCGTTCTCCCCCCATCCTGGAAGATGCAACCTGC
GTCATCTGGGATGGGGCATGAATCTTCTTGCGGCGTGGGGGATTTTTCCAGCGACGCTTTGACGCTTTGAGACTAAACGCGGCTTTGTATCGGATTGCGC
TATCGCTCGAAGGCGCTCCCATTCACAAGCTCAAGCTCAAGGCAAAAAGAGGAGCCATAAATAGCATTCAGGCTCTTGTAATCAGAGCTCTCTCTCTGTC
GGTGCGCTGCCTGTTGCCACCACTCCATCACTTGACCGCTTGCGTCCCAAGCACCAGCCGCTTCGCTCGTCAGCCAACCAGACCGCGTGCGGACGCCAAG
CGACATTATTGCGCATTGCTGCATCTACGCAACATCTGTCGCATCGTCAGCATTATCGTTGGCACCCTCTAAAGCGCCATCTCAAGGTCTTCAGTTGCTT
GGACGCGTCAGTATTGGCTGCTTAGACGCTCGACACTCTTCAGTTCGCATTTTAGATTCAAGCGACACAGGCACACACACACACACAAGATGGCGACCGC
GACAGCAACGAAGAATGCCAGCAGCGCACAGGAGGCTGCACCGCTCCAGGTGGCCGCACCCGTGATCGCGTCGCAATACGCGCGCTTCTTGGCCGGCGGG
CTGGCGTCCGCGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTGCACGAAAGTGCGACTGCAGGCGCAGCGCGTCGTGTCGGCT
CCGGCGGCGGCGACGGCGATGCTCTCGACGAATGTCGGCATGGTCTCGACTGCGACGACGGCAGCGCGGCAAGAGGTGCAATACACGGGCATGGTCGACG
CGGTGCGGACGATCGTGAAGGAAGAGGGCCCCGGCGCTCTCTGGAAAGGCGCAACCCCGGCGCTCCTGCGTCAGGTGTCGTACACGAGCATCTGCATGGT
GCTCTACGAGCCGCTGCGCGATTTCTTTGGCGCGAACAACGCCAACAAGAGCGAAGTGCCATTCGTGAATCGTTTCCTCGCCGGCGGCTTTGCCGGTGCG
ATCGGAATCACTGTCGCAAACCCGTAAGTGTTTGCATTTCTATTCTGTATGTGTCTGTGTGTGTGAATGTGGTCATGTTGTTGTGCCACGCGTCGTTTTG
TTGAGCTGTTCGTCACTCATCTTTGTATCTCTCTGTGGTCGACTATCGATCTGATTATGATATGCCAACAGAGTGGATGTCATTAAAGTACGCATGCAGG
CAGACCGCTCGGGCACGCTCTACCGCGGTGTTGGCGACGCGCTGACCAAGATCTACCAGCGTGAGGGCATGCGCGGCTTTCTGAGGGTATGTTGCTACCG
CTATTGTTGAAATATATTATTGCTTTACCATGACGCATGCACTAAACGCTATCCACATGTATCATCACAATGCAGGGCATGCCGCCGAACATCCAGCGCG
GCTTCATCGTGAACGCGGCCGAGCTCGGCACGTACGACCACAGCAAGGAGTGGCTGATCACGTCAGGTTTGCTATCGGATGGCGTGTTTGCGCACACGGG
CGCGAGTTGCGTTGCGGGCTTTGCCGGCGCCGCGGCGTCCAATCCGATCGACGTGATCAAGACGCGCCTGATGAGCCAGCCGACCGACGCCACGGGCAAG
GGCTCGCTGTATGCCGGCATGGGCGACTGCGCCAAGAAGACGTTCCAGGAAGGAGGTGTGCAGGCCTTTTACAAGGGCTTCATTCCCAACTGGATGCGCA
AGGCGCCGTGGTGCGTCATCTTCTTCGTCACCTACGAGCAGTACCGCGCGGCGCTCTTTGACCAGGAGGAGTGAGGTGCTGTGTGTTGATAATTATATAA
CATGACGAAAAAACAAAGAGAATGAAACTGTTCATATCCCGCTGCTATTGTTGCGCAATTATCACGCATTTTCAGTCGAGAAATGAATAGGCGGCGATGC
AAATGACTTGGCATGTTGCTGGAGATGAGGGTATTCTAATGTGGATAGAGCAAACAGCCGCGAATGTCTAACAATGATGAAATGGTGTCATTTAAATACT
GTTTACTTCACACACGGTGCTTGCTTTCTAACCAAGCAGGTGGCGCGTGGCTAAGAGAGGACGAGATAGCCTGCTAACTGCATACTACTTACTAGGCATC
CCTTGGGTTCTCTTCAATATGCTAAAATGGGAAGAAAATAAAAGACAAATAATTAACAATGCAACGCTTCAAAGTCCCGCATCTGGATGCACCACGTGGA
GCGCGGCGGTGTCAAGTAGCAGACGTGGTCCTTGAGCTCGTTCTGCATCTTTTGCTCCATCTGCTCGCTCAGGTCGATGTACTCGGCCGTGTGCATGACA
TTGAGCTTTGGGTTGTCCGCGGGCGACGAGATCTTGCCGTCCTTGGGCAGCAGCACGATCGGTAGCCGCTCTGTCTCCTCCTTCGCCCACCGGTCGCGCG
AGATCACGTGCACGCTGTAGCGCGAGAACGAGCCGTTCATCATGCGGTTCGAAATCGTGCTCTCCACCGACGGCGTGGGTGACTCATCGTCGTCATCGTC
GTCGTCGTAGCAAAAGTATGCGGGCCGTCGGCGGCGACCGCTCTCGGTCGTGCTGCTACCTTTCGAGAGTAGTAAGTGGCGGAATTGCTCACGTTCGCGC
CTCCGGGATTCCAGGATCTCTTCACGGGAGCACGCGCGGCTCTGGGTGTTGCTGTGTGGCTGCTGGTGCATGTTAACGGTCGTGTTCGCTGCGGTGTTCG
CGTGGATCACGTGAGAGCCCATGTTCACCGGTGCCACTTGGCTCAGTCGATTGCCTTCCATGTTCATCAAGAGCTTCTGAAGTGCGAGAAACGTCTCGTC
GATCTCGTCGTCCTCATCCTCCGTGTCGTCCTCGGGCTCGAGCACCAGAGACACCTTCTTCGTCCTCTTGGGGCTGCTGCTGCCAGCTGCCGGTGTTGAC
GTTGCACTTGCCGTAGCAGATGCCGTCTGATGCGATTGCTGCGCCATGCCGCTGCTCTCGTACCGTTCTCTCGCAAATGCGCTCATCATGATGCTGTCTA
TCGTCGTCGTCTTCGTTCTTAACTGCCTGGCGTTCTCTTGCTCGCTGCTTGGTCAATTGTTTAATGAAGCTTGCATGCGCTTCTCTATCGCTTGCTGTGT
GAGTGCGTAAGTGAAGAGATCAGAGAGATGATGCGAGATGACGTCTTCAACGTGCCGATCCGACTAATCGACCGACCGCTCGCTTTTCCAACGGAACTGC
TTGCGCTTTGCTCGCTCGTCTGCGAAAAACTTCTTTGCACTCGTGTCCAACGTTCACGACGCTGTTTCACGTTGCGTTTTGCGCTTTCCTTGTCGCTTAA
AAAAATGGGAGGGGGGGGAGGAGACAGCCGTCGATGGAGAGCTCTTGCCAAAATGCGCGTCGTCGTCGTCTTCCTGTTCGCGGCCGTCTGTCGCTCGATT
ACGCCTTGTGACCTCGCTCGCGTGGTTCCAGCGAAGCGCAACTGATCGAATGGAGCGAGAGAGGAGAGCTGATGGGGATAGAATTGATGATAGCAAGCGC
GACACCTTCACACGACTTGCTTTTTGTATGGGCGAAACTGCTGCCTGCGATGAATGAATCAACTCCGTCATCTGCCCAGACCTGACTGAAATATTGCGCG
TTTCGGTATTTTATGGCGAAAGAATAAGGTGATGGAAACAAGACGCGCGCTTTGGAACATACAAATGGAGCGGAGAGCGCGCTTTTGAAAACTATCCACT
CGAAATAAGTTGCGACTTCTAAAACTGGGTGAAATTGAGCCTAACAGTTACAGAGAAAGAGCTGATTGGGGGAAACGTTCGAAATATGGTCTCTATCGCA
CAACCTCGCTCTTAGTTTGGTAGGCGACACCCTCATGTGAGAACTTCAGTTGCCGCGGCAACTCCCAGACGGATAATCTGGTGAGTAGGGTTGATCTTCA
GATGACTGCGTGAAATCCACCAATGGGAGAGCGTATAAATTTCCGACCAAGGCGCTACCGTAATCTCCGCGTTTATACCTCGCTCGCTCGCCCTCTTCTG
TTTCGTCCGCAGTCAGCAGATCAAATGTGCCAGAGAAGCGCAAAATGAGCTTTGCCTCTTGGTATCTCATGGGAAAAGTGAATCAACATGGTAAACGGCA
GGTTGCGCTAGCTTGACATGGAGCAGATAACCAAGCATAGCACGCGCACCGCTGCCTGCACAGATAATGGATTGTAGACTTAGCAGGCACTAATGGGTGG
AATGGCCAATATTGCAGCATTACTATTGTTTTGTGCATTCGTAGGGTCAGTACGAGAGTCAAGAAGGCAGATAATTCTTTTTAGAACATAGAGAAGGAAG
GAGTTTGGTGGGGCCAGTACTGATTAATTGAGCTCCATGTGCATGAAGCTCTCTGTCATTCTCGTTTGTCTGCAGAAGTGTCCAGTCACTCACTCCCTCT
TCAGAAGAGGAGGGAGAATGGAGGAGACTCAACCTTCGTTGGTATTGACGATCGATTGAAGCAATTTTTTCGCATGGGACTTTTTGACCTGCGGTTGTTG
GATTTTCATGTGCGGAGACTGTGTTATTTGCTAGTAATGGTGGCTACGCAACAGGGAAGAGCAATTTGTAGCTTGTGTTTGGGTTTGAGGGTGCAATCCA
ACGCAATGATACGTATGGCGCATCAACCATCACCACCCCATGTCCATGGATTTGGCTGCAGACAGAGCGCCATATCCACTCACATTTGCTTGCGCAATGC
TGCAATGCTGCCGTGCTGGTCGTATATTTTCAACGTGTAGCGTATTCGTTTTCCTGGACGTATATTTCCGGCGGACACAATACAACAATTCCCAGAAGCG
TGTCGCTTCGTGGTCGCCATTTTCTGATGGTACTGGGCGGGGGTGAATGAAGTGAAAGATGGCTCCTCAAGAGCCGCCGTCGCGACCGATCGCGAATGTC
ATCATCGCGAAGTCAACAGAGTGAGCGCGCTCCGCAGTGACAAGAAACCAAGCAACACATACACACCTGCATCTAGTGAACCCCGGGAGTGCGTGTGGAC
CTGCCGTTAATCATGTCGGACCTGTTGCTCTTCTGGCTCAACCACGAGCTGCAGCTCTCGAGCTTCGTGACCGACGTGGAGCGCGACTTTGCGAGCGGTT
ATCTGCTGGGCGAGATCCTCTTTCAGCTCAACCAGCAGCACAACTTCTCGGACTTCATGAACAGCAGCATCGCGGACGCCAAGATCGTCAACTTCTGCCT
GCTCGAGCCGAGTCTGCGCAACATGGGCGTCAAGTTCGACTCCAAGGCGGCCACGGCGATCATGAACGGCAGGAAAGGCGCGGCCGCGAGTCTGCTCTAC
CAAATCAAGGTACTGTGTGTATAGAAACAATATGGCTGTGTGTGCATAGTGTACTATGGCATCTCATCATTATCTTGTTATTGGGTATGGTTGCATTGTG
CTCATGTGTAGATGACCGCGACGAGGATCGGACGCGCGCCGGACGTATCCACCAAGTCGCTCGAACGAAAATCCGTCCTGCCCCTGCCCAACATGCCCGC
GAAGCTTGCCAAGCCTGCGTTCGATTCCGGCAACCACTCGTTCTTCGAGCACTCGGTGCGAAGACGCGTCAATTCGCTCGCCGCGCTCAAGCGGGAAAAG
TACGTATACCCACCATCGCTTATATGCCATTATTGCCTGCACGCTCACATGTAATAATGCGTTGTCTGTATGGATGTTGTTGCATGCAGAAAGGAGATCG
CAGAGGAAGCGCGCAAGAAACAGGAGTATCTGCGCAGCCAGGAGGAGATCAAGGAGCAGCTGGAGCTCACGAAGGCCGAACGGCTCCACCAAGCGTTCAT
CCACAGCCATTTCATCAAAGAAGCGCTCGAAGAGACGGATTCGCCGGTGTGGCGCGCCGCGCTCGAGAAGAAAGGCGAGCGCGAGCAGCGCAAAGCGCAT
TTCTACCAGCAGCTGCTGGCACATCGAGCTAAGCAGCAGGTACAGAACGCAAATGATGGTTCTATGCCTTGTAGGGGTATTAGGCTATGAGTGTTTAACT
TCATCCGTTTGATACAGGAAGAGCACACATTCAGTCTTCGCCAGACTGTGAAAGAAGACCTGAACGAGTTTGAGGTATGTGGATGTGGAGATGCATACAA
ACTCTGACAATGGCTCTGTGCCAGAAATTGGTTTGAATGAATTATGCACGCTAACTTCCGATCGTTTTGCTTGTTAGACTCGACATGGACCAAAAGCGCA
TTCAAAAGGCTCGCTGCTCCCGTCTCAGAAATCCGTCGGCTACGGGCTTCGCTCTCTGAGCACTACTTTGGAAAAGACAGACAGCGCAAACAGCGCCTCG
CTGATCTCTGCGTCTTCCCGTCAGGCGTCTGAGCGAGACGGCGATCGAGTGGAATTGGCAAACAACATCAGCGCCATCAAGGAACAGAAGCAGCGCCGCG
AGAAGCGCAAAGAGCAGCTCGAGCGGCGCCGTAAGCGGTTCGTGCAGGAATGCGGGTACTACCACTCGCACCTGAACATCGTTCGCACGAGCACGGCGCT
CGAAGCACTCGTGGCGAGAGAGACGAACAGTGAGAAGGACGTCCGCAAGGATATCGACAATGTTATCCTCTACAAGGAGGTCACGCGTGAGAACAGAGAG
CAGAGAGGTCTCGAATACGGCAAACAGAAGCGCGCCGACATGGAAGCGGCGGTCGACCGAGACGCGAGTGTCTACGGAAGACTGATACTGCGCTACGAAG
ATGACAGCGAGATGCAGATTCTGCAGAAACAGCACCTGCTGACTGCGACCCAGGCATCCAAGCGCCATGAGAACGAGCTCATTGCGTCGAGCATCATGCA
GGAAGTGGTGGATTTCGCGATGTTTGTCGCAGGAAAGCGAGAAGAGACGCTTTTCGCGCGTACTCCGGCGCTTTTCTTACCGGAAGAGACGTGGACAGAG
TACAAAGTGCAGTTCGCAAATGGTTGTGTGCTGGGTATTGCTGATATTGGAGATGATGGTGATGACTCGGAGCTGCTCAGCAAGTACCAATTAGAGCAGT
ACCTGGGGTCGTTTCTCCCATTTATGCGGAATTCCGACTACGTGGGGTCTTCTGTAATGGGAACGGCGCTATCACCGTGGTATCCGCGCAATGTCAAATT
CATCGGAGCTGTTGACACCCTGGAAGGCCGATTCGTGTTGGGTGAAGAAGTGAAGTACGTGCGGTGGATCAGCAAGATGATGGCAGGATCTTCGCCGTCA
CCACCACCTGCAAGTCCAAACATTGGCAAAGAAAAGGAGCAAAACGAGAGTCAAAGTCCACAACTGGAAGCTGCTGCCACATCACCAGAGACAGGACAAG
AGACTGCTGATGAAGAGACTCAAGATTCAATATTCGGCACGCCAGGTGCGGAGCCTGTAAAGCAGTCAATCGTCGCCATTACTCCACCAACGCTTCTCCG
TATACTGGTGTTTGGCTCTCCATTCGCTGGCAAGAAGACGCATGCGACTCGCGTCGCCGAGAAGTACGATCTGGAAGTGATCTCTGTGCATAGTCTCTTG
GAAGAGGCGATTGAGAAGCAGAGTGCGATCGGAGTTGAAGCGCAGCAGCTTCTTTCGAGTGGACGTGAGATCTCGGCACACATTTACAGTCGACTGGTCC
TGGACGCAGTTCACGCACTGGAGGCATCAATAACAGTGAAACTGGCTGCTGCGCCTGATGGTCCTACTGATAAAGAAGAAGCACAAGGAGAACCAAAGTC
AAGTACACCCAAGAAAGGCTGGATCGTGTACGATCTACCTGGCACCGAGGAGCAAGGCCGCAATTTTGAAGAGCTGCTTACGGGTTTTGTGGACCCGTCG
TTGATTGCCTCCCCTTTTGACTGTGAGTCTGCGATCGCCCCAGGGTGCGTGAAACCAAAGCTCCCGTCCAGTTTCCTGCACGGCAAGTCCGGGGTCGACC
TGGTGTTTTACTTGGACTGTGCGTGCGAGACTGCGGTGGAGCGGTGTCTAGGGCAACTGGAGGACGACGCGACCCACAAGAAGTTCCACCTCGTGTACAG
CCCACCGTCGCACGAGTCCACGGATCGCCATCGTCTTTCCCACACGAACGCGAGTCTGAACTGCAGCGAGCTTCTGTCCATCCAGTGCCTCTCGGTGGAG
GATTTCGTGAAATCCCAGAAGCCATGGTACCAGAAGTTCGACACGTTGAGAGAAGTGGGTACTTCAATTGGC