Description :
From Genome Similarity Track
Location :
Scaffold_29:121295- 122737
Sequence
1442 bases(100 bases per row)
TTTGGTGTACTTGGAGTTCCGATGCTGGTTATTCTCCTTGTCTGTCTAGCATGGACATCGTGGCTGATTTTCTTGGCTCTTGCACCAAACAAAGCAGCGA
ATATGCTCATGGACACGAGTTCGTACGACAATGGACAGTTCTGGTTATTTAACGATGCACATCCGCAAATGGTTCTTGCTGGAGCTATGGGGTTGGCTAT
TGTGGACACTTGTTACTTGGTCGTGACGTTGCGGATGTTGCTATGGCGCGATAAGTTGTTCGGCTCAGCTTATCATACCAGTCGTTCAACGACTAGTGTC
ACAGGCCCGCACTCCTGGATGAGGAATAGACGACCAACATATAAACGTCTCCGACTTGTTTGGGAGGAGCTTACAGCTTTCGAGGGACGAAATCGCAAAA
AATGGGTAGGCGTCATGTGTTGAATTTTACTTCAATTACTGTAGTACTTGTTAACAGCATTATTTTGCAGAATGCATTTCTCAAGCTAATAGACCTGGCC
ATGGAGACAGCGCTACTTCGTCAGCTTCTGCAAAGTGGAAGCCCCGTCAGCCTCACCTATGGTTTTGCTACTTTCTTGGCAGTGAACGCGTTGTCGTGCG
TCGTGAACGTGCTCACCGACCGATTTTCAGCGCTGACAGAAGTTTTCATCGACTCTGTGTACGTTTTCTGTTGGAAAAAACGATGAACGCCGTAGTACTG
AATTCTCTGTGTACCTCTCAGTTTCGACTTGTCGGCAGCAGTGTTGTTCCCGATCACAACGCTTGTCTACTGCTACTATAATTTCGACTTTGATCGAGAA
GTTTATCTCACATACCTGGAGAAACTCCCGGCTGGCAGCTTCGAACATCTCGCTCGGTCATTTGCAGACCAGTCAGAAATTGCTCTCTTTCGTGTAAATT
TCGACTCGCTCCGCATCGACTCACTCGTGGATTTTGGGTTACGCATCAGTATGAATCTGACGTTTTGTTATCGCTTCGAGCGTTTACTTCAGGCAATTGT
TTGGACACGGCATCGCGAATTGATTGTGAAGAGGCTTATTACACCGACAAATGCTACGCAGAATCCAGTTCCCAAAGCGATCACGGCCGTGTTCGTTGCA
GTGAGCTTGGTAGTGTTACTATCAACTCACAAAGCTGTCGCAGATTCAACCGCGTTGTGTTCTTCACATCCGGAATGTGTTGTGTATGCACACCAGTGGG
AAACCAGCGATACTTATTGTCCATGCCTCATTCTTATCGATGTCAATCTCACACCCAAGACTTATGAGGAATGGATACATCCTATCGACGCATACGACAA
AGTGAAAGCTCTCGCTGGTGCCGGGATGCTCAGGTCCCTTCAAGTGATCAACCGCCAGCTTTTAGAATGGCCGGAAGAGCTTCGAAAGTGCCGTGATATC
AGAGTCATGTGCGTTATGTTAGCCATAGCAACTCCGATCTCT