Description :
From Genome Similarity Track
Location :
scaffold_541:12128- 22108
Transcript NameFunction/comments
g9100.t1hypothetical protein

Sequence
9980 bases(100 bases per row)
TCCTGGTGCTTCTTCTTCAAAACCGACTCGAGCGCGCGCTTCTTGGGCGACAGTTTCCGGTTTTGCCAGAACACGTAAGTGCCGGTGGGGTTTGTCTTCT
CTGCAGTCTCTTCATCCTTAGACAGCAGGTCTTCATTGCCCTCGTCTATTGCCGCGGTCCTTGAGCTTTTACCATGCTGCAGCAGCGGCGGAGCCCGCCC
ACTAACCTTACGCATCAGTTTGTGCGCTAGGGATTCGCGACGGTCTTGTAGTTCTCGCAGAAGATTTTGTCGCTTCACAAGTAGCTCTGCCCGCGGGTCT
GCACGAGGCCCAAATCGATCAGACGAGCTCACGAGCTTCTCGTCAATGGATTTCTTGGATGCTGGTTGCTCGGCATTTCCCTGGCTTTGTGTCTCGAGCT
GTTGATGATACTCACGCACGCAGTGCATGCCATACAGGAAGTGCTCAAAGTCCACGAGGTCTGCATACGCCGGGTCAAACGCTTCAAGCAACTCGCGAAC
TTTCGTCGCTGGCACATGCACACCCAGCTCGTACACAGCCTTCGCGATAGCTGTATACGAGACTAAGCCCAGCTTAGCTGCATCCACCGACGTGAACAAC
AGCCTGAACGCGTCAATCTCTTCCTCACTGAAGTTCTTGATCGTCCTTCGCAGTATTTCTCGCCTTCGGACAGCCAGAAGTCGGTGCTGCTCTTGCTTGC
GATCTCGAAGATGGCGAAGATATCGTGCACGGGTGACTCGCGTGAGCAACCGGCGCTGGATGCGAACTGCAGCAGTGTAGCGGAGACGCTCATACAGCGT
GAGTGATGCTCCGCGTTCAAGTGCTTTTGCGTCTTGTGGCCCAATACGCAGTAGAGCACGCCCACGCAGGATGATTCTCGCTAGCAGCGTGTGAGACCAC
CAGTGATGCAGTGTGCGAGCGACAATGGACACGAAGATCACGATCGGCTCTGCTACCAGTTCCTGAATCGCCACACCGATGGACCAGGCAAGAACACAGC
GCCAAGACGTCGCCAAGCCAAGCTCCATTGCGCTGATAGTGATCACGTAAGCCATGATCACCAACCAGACCAGACAGAACGCGAACACCACGTAGACGAT
CGATGCCGGGTACGGGACGTCGTCATCAGCTGGCGGCTCGGTTTTGGCCAAGAGAGGGTCTTTGTTGCCACCTTGGTGATTTAGACCTGTTACGGTGCTG
GAGATCTGTTCCTGATTATGATTCAATGGTGCTGCAGCCAGCTCATTAGCCATTGACGGCGCAACGCTGTCCAGACTCGAAGCCAATATTTGCGAGCGCA
GTTTCCCGCGTGTAGGAGCAGCAATTTTCAGTCCGACAACAGTCTCAAACGTTTCACGCACGTCTCGCTTCACTTCACCAGCAGCAGAATCAGGCACTCG
TAACTTGAGATTGACATCCCTGGAAATGACTAGTTCACGAGCTAGAAAGAGTGAAGATAGGATCATCAAGAACAGCAGTCCAACTGCAGTCAGCGCACAG
TACGTCGCTACGTCTGCCCCAGCTTGGAATCGAGCGAGCATGCCTGCACGGCATCCTGGTAAGGTGGTGAACTGCTGCTTCGTTTCGGTCAAAACTGTGC
CGCTTACACTCAAAGCTTCGTACGTGACGTCGACTGGATCTCCTTCGGGACAAGGCAGGAAGGGGGCATTCGTAGCATCCCAGAACCCGCAACATCTCAT
TTCCTGCTGGACGGTATCCTTCGCGTAACCTATAAGGTCTGTGTTCCATGCTACCTCAAGGCGTTCAGCGACGCTGAAGCCCGTGGCACGTACACTCCAG
CTATTCAGCGCACTAGCGTCGTCCTGCACCACTTCGTGGATCATGAACACCGTTAATAGCACCACACCGAGTGCTAGCACAGAAGTAATCGCTACGACGA
CCAGCAGCACAATGGTTGGGGTTGCCCTGCGACGATATGACCGTTTCAGATGCCGCTCCCGTAGATCGTTCGCCAGTGCTGCAAGTAAAGCAACGGCGAT
AAGCCCACAAGCGAGGGCTAGTAGCTCAAAAACATTCTCGTCTAGTGGCACACCGTAGAGAGAGTTGTTGTAGCCCAGTCGAAGCAGCCCAAGAAGCGTT
GCCAGTGCACAGCCTCCAAGAAGCAGGATTGCCCCGCACGTCTGGAATGTCACCGCTACGAACCGTGCGAGCCAAACAAACCAGCGCTCCTCGGTCGTAG
CCTGTGTGGCCCCGAGTGTAGATGTATCGCTGCTTAAGGCTGACTGCTCTGTCACTTTATAGGAATCCGGTCGACGTCGAAACCACGGCGTACGGAACAG
CATAACCTTTTCCTTCCGCTGGCGAGCGGTGGAGACTTCCTTAGTTTCTTCATCAGTTCGGTGACGAACATGTTCGAAAAGAGCGACAGTAGCTGTCTGT
ACTGCAAGACCTACGACGCCTCCATACGCCAGACCAAGACCAAGTAACACTCCTGCGCCTGGTTGCTTGCAAGACTTAAGTGCTGTCCGATAACATCCCT
TCGTGGCAAAGTGACCGGCATACACTGCAAGCGATGCAGCCCACGCACAAAGTACACTAATGGCACGTTGCGTCCGTGTAAGGCGTGCGTCAAACCTTGC
GCCGATCGAAACCAATACGTGATTCCGCTGGAAGTCCCGTCGAAAGCTACCGGCCACGTAACGAAGTCTGCTTTCGAGGGCAAACCAAGCCTCTCCTTCG
TATTTCCGGACATCATGTAGGACAAGAGCTCCCAATAGCATAACCTCGATTTCCAAGAGTGCAAGAGCCAGAAGAAACGCAAATAACCAAGTAAACGAAG
ATTCGACCCCAATCATGAGAGGAACCTTGCACCCACGGGAGATTGCCAGTGAACAGCCAGGGTATCCGAGAGCGGGGCGGTCGAACACGACGCCTTGTCC
AGCTACAAGCACTGGGTCGTTGAAACCACAGCACGAAAACTCGAGAGCTATTGCATTTTGCTTTGAAGGAGGTAGTAAACTCCATTGATCGTCCAGGAAG
TCTGCGAGTTGAGCGTGCCAGTGTTCATCGGAAAGCGAGGAGTAGTGCGATAAGTAAGCCGTGAACCCCACCGCAGCGAAAAGAGCAACCTCCAGCATGA
ATCTTCCCACACACTGCAAGAAGAGTTGGGGCACGCTGAGATGCAAAACTGCACGCATTGAATACGAGTGAATAAGTAGTGCAAGTACGCCATAAAGCAT
CAGTGACGCGCCCATAGATTTTGCAAACACCATTTGAAACGCAGTCGAGCTGAAGAGCGTCCAGTTGACGGCTACATCCAGGCCAAATATGAAACAGGCC
AATGCAGCTAATATCCCTGCTAAATTCGAGAGGAGTAACACTGATAGCTCGATGCGAAGACGCCAGCCAGGTTGCCACTTCCTCTCGCGTTGGTCAGTGT
CATACAAGCCCCAAGCACAGAGCAGGGCTGCACCACTATAGCCAGCCAGCCCAATGCACAATTTCCAAGTTATTCGAGCCACTCGTGAGACGTACCGCTT
CATCGACGAAGCACATCCATTGGAAACATCATTGGGGCATTGGGATCTACTATCCAGACGCACCACTTCTGTCTGAGTTTCTGTCAGCATTCGTGTCTTG
CTCGACTCCTTTTTTGCATCGCTGTAGACATGATACATAGACGTTGAACTGAGTCTCCGCCACCCGAACTGTTCAGCTTGCAGTGTGTACGAGATCGAGC
CGTTGGCAGCTTCAACTCGGTCATACCCACAGCACTTAAATGTGTTCTGCACGAACAATTTGGTCGTAGAAGGAGCCGAGCTCCACAGATTCTTCATGCG
CATATCAACGGCCAGTTCTTGAGCTGTCATGCCCTCGCCGTCTGTCGTAAGCATGAACTGAGTCGACAATTTGTGTCCCACCCCGGCAAGCACAAAAGCG
GTGACGAACAACACAACACACGCCACCGAATACCAAATTACGAGCCACTTTCTAACCGATTTCCATCGTGGTCGGTGTTGTTGAGTTCCTTGTGAACCGA
GCCACGCAACGGCACCGCCGAATAACGCGAAAAGCTCCATTACACCCCCGAAGATTATCAGATACACACCCAGACGGCGGTCGAATACCCGCAGAAGGTA
GGATATTTGCAGCACATTAAGTTCCAGCAGAATATCAATACCTAGACACAAGATACCGATGCCGGATGCAACAGCCCCCACATTTAACAGCCCTAGACCA
CCGGCGCACAGCTTTTGAGACATTGTCGGTGGTTTATAAGCCTCGAGAGCTTCAGTTGCGGTCGGAACCGATCGGATTCCAACGACATTCGAGTATTGAC
GTAGCTGGAAACACAGCCAAGCCAACAAAACGAGCATGATAGCTTGAGCCACAACGAAACCCGCAAGGCGATCTTCTGATAACGCTAAAGCACGCTCTAG
AGCGTCCTCGACTTGTACGCGACATGTTGGAACACCTGTATTCGATGTGCCTTCAACGCAAACGCCCTGTGAACTAGAACGAAAGCCGCAACACCCCAAA
GCCATCTCTAACCTCAGTAAAGTAGTGGAACGAGGCAACGCCACGTATTGTGCCTCCACCGCTTGGCTGATTAACGGGTCCAAGTAAAAGTCTGCGTGAA
GGCGTCCGACATACGTGCGTACTGCAAGCGTTAGTAGTAAGAAGACCAATGATAAGCCGAGAATCCAGCGGAGGGCTCGTATGTCGCGCCTACCAAGTGC
ATGTAGCGTCCACAACGTAAGAAACAGATACACACCGCTGCCAGTGATGATAAATACACCGATCTCAGCTCCGAACAGCGCAGAGACCAATTGATCCGCC
ATGGCCCCCCAATGTACCATCAAGTCCACTCCGAAGATCACTCCACCGATTGCAGCACAGCAGAGCAGCGCGTACAGCGGAGATAACGAGCACAAGAGCG
CTGTTGACACCAGGGACCGAACAATAGCCACCTCAGGACCGGACGCAAGCTGTACCAGTCGAATATGCCGCCACCGGATGAGGAAATTCGCCACAGCTAC
GCACACAACCTCCACTAACAGAAGTACTTCCACGTAGATAAACGAGCTAGAGAACAGTGCAGACGCCTGCGACCCGAGGACCACGGAGCATGTTCGCGGC
GGAACTGCAGTCAAGGCTTCCTCAGGACAAGTTGCTTCCTCTTTGATGTCCAGGAACCCACAGCATCCATAGGAAAGCTGCAGTTGCGTCTTGTCTCCGA
GCGATAAAGCGTCCCATTTCGAGCGCAATGCAAGAGCTACACCGCGCGGGATGGCGTCAAGGTTCTCGAGTAGGTGGAACGCGAACAACACAGCCAGGAA
CTGGATTAACAAAGCGACACTTAGCGAGGTGAAATACGCCGTTCGAGCTGCGTTGGAAGCTTCTCGTCGCGCAAGAAGAACGCCAACGATCCCTCCTGTT
ACCAGCACTGCACCACCAATTACGAGGGCTGCCCCTAGTGGCCCACTGTACAGGTACAGCACTAATTCTGCTGGCGTTCGTCCAAGTACGAAATGCACTT
CGATACCAGCGAATAACAACACAATTCCCAGCAGAATTAGGGCCAAGTTGCTCACTCGGAACAATAGAGTCACTCGTTGGTACTGGCGATTCACGAGAGC
TGAAGACCCGAACAAGGTGCGAGCTTCATCGGGTAACTGGACGGACGTATCTAGCGGCTCTTGAAGGCGTTCAATGCCGTTCGTGTGCACCTCATGCAGA
GACGCAGAAGATTCACTGTATGTGGTTACAGTATGTCGCTTTTCCAGTCGTTTCTGCTTCTGAGCGACATAGTACGCGTCAAAGTCTCCGAAGACGTTGT
TGGTCTGAGTTTGAGCTTCCAGTTCGCTCCACTTGGCTCGATTGAGCCTCCTAATTGTCGCGACTTTCTCGCGTTCTACGTCGCGCACATCCAGTTGCTG
TCCGACTTTGGCAACGAGGACAAACACACCGACCAAAACAGCTAGAGTGACACTGACGACGAGAGAAGGCTGGTCATTCCGATATAGATCCGGATGCAGC
GCGTAGAAATCCAAGCGTTCCTCCAGCGTCACCAGCACTTGAAGAGCGGTCTCGACTTGAGTGCAGTAGCAAACTGTAAAATTCTTTGCACTGGTGCTGT
CGTCTTTAAAACACACATCCACAGCCCACTCTAAAGCAGCGGCGTCCCAAGTCCGACACGTCGTGGAGAAGTTACTCTGCTCAATAGTCGAAAGCTCTCG
AGCATGTGGGATAGTCACAGCTAGCAGCGGCATCCACTTCTCGGTCTCATCTAGACGCCGTGTCATCTCTGAAGCAGCCTTGACACAGGAACTTGTACGA
GGTAAACTCTGCATGGTCACACCTGTATCTGAAGCGTACGTCGTGAGTGTAGAAGCGTTATCTAGTGCAGCTTGAGAGTGCACTGAGAACAGCGTAAGTC
TTGAAATCGGTTCGGAGTTGTTCAGCGTGGACGCTGGATGTGGACTTTTGCCAAACGATAGTGCGTCCAAGAAGAGATTCGACTCAAGACACGACACTGC
AGTGGGCGTAAGAGCCATCGACACGTCGCTGGAACCTGCAAAGCGAACGCCTTTGGCTGAATACGTGCGTATGTCACTAGCTTCAAGTACAGCAGGCGGC
TCGTCAGCAAGTAAGCCGTCGCTGCTCAGTGCAGCCAGCGATTGAAGCGTGCGCACCATATTCGTCCAGCTCGTTACATTTCCTGCGGTAGAATTTCCCA
GTCCGAGAAGGATTGAGATCACTTCCAGCAACGTATCACTACTTGAGTCCAAGAATGTATCCGGTGCATCGAGAGTAAGGGCGCTCCCAGCAATCCCGCT
CATGAGTTGCGTCACCAGGTTAAGATCTTCAGCACCCAGCACTTGAGCAGCTGCCCGCACAACGGACACCAGTACTCGACTTTGCTGTCCCAGTCCCGAG
CTACTAGGCTCAACGGAACTGACAGCAGTTGATACGTAAGACAAGATAGCGCCACTAATTTTCTGCACAAGGGAGATCTTCGTAGAACAGTCGGAGCCCA
TGAATCCCTCAGGACAAGTAGCAAGACGTCGAGCAGTCGATTTTGACCCGAACGCCTTCTCCAGCACCATTGCTGCAGCTAAAACCTGCCGAACGTTATC
TGATGCATCGCTGCTAGTTTTAAGTGTTCCAGTATCGGAAAACAGGTTGGAGACGAAAAGTGCCGGTGATGCCTTGGCTTGTTGAGGCATCAGAACTTCG
ATATCATCATAAGCGAGTGCTGTAGCTCCAAGCCGGTCGCTGATAAACGCCAACACTGTCACATTCTCATTGTCCGCCATGTTCGTAGGTGGAAACATCT
TCGCCGTAGCTTGGGGCGAGGCTTGGCTTGCTACTAACGGTGTCATTGCCTTCCGTAGCTGCGCGATCAACGTGTTGATATCTACTGAAGAATTCTTGAG
CGAGCGAAACGTAGCAGAAGAAAGCACCCCAAAGTCGTAACTCAGCGGATAGTCATCAGCATCATCGCTCCATAACGAACACGCGAGTGAGAACAAGTCC
TGCATGGCGTAACCTGATTGCGGAGTCACAATGAAAACTCCCGAAGATGGTGGGGAATTCACTGCTATAGATACCGATCCAAAGCCAATATTCCCTCCAG
TGTCAGTAGCTACCAGTCGGAAGGTGTACGTGAGTCCAGCCGTTAATGTGTAGCTTGGAATCGCGTTGTTCGCACTGGTGAGTGGTAGAGTGAAGACGTC
GCTGGAATTGCTTACATTTGCAGTTGGAAGAACCAGATCCCCCAGTGTTTGTGTCCACCGTGTAGTGAACGGATAGTCCGAAGTTACGACTCCCGAGAGC
GACAGGCGGCTCGATGGATTAATTTTTCCAGCGGATGCAGTAACTTGAACAACTGGGAGATAGCCAGCCATGGTCCAAATACTGCTGGAAGCCGTGGCAC
TACGCGAACCTTTCGAGGCTGTCAACGAGAAATTGAGCTGGCGACTTGGTACGAGATTGAAGGGGGCAATTCGAAGCACAGGCTCCGTCGCTGCATCCAG
TGCTAAAGGGCTGGAAGGCGCTGAAGCGTTCATACAGGATGTCACTGCGGAGGAATTCGTCACGTCTTGGCAAGTCCATGTGTATGTGAACGGGGTACTA
GAAAAGTCCGGATCAACTGTTGTAGATCCGTCGAGGACCATTGTATCTCGCTGCCCAAGGGCGCAGTCGCCGCCCTTAATAAACACTTGCGGCGAACTAC
TGGAGACGACCACCACGATTGATGTGAAGCTGGACTGACTGGACGTCGATCCCTTTATGTAGGCTTCGGCTCGGAATGTGTACGTTAAACCAGCTTGAAG
AGCTGAGCGTGGTACGCGGAACACTCGCGGGTCTCGAGAATTGTCCTTGCTGAAGTCCACCGCTGTTCCGTCACTACTTTGACTTGTCCAACGGAACGCG
ACATCCGAACTGGACAACGTTGGACAACTAACTGTAGCGTCCACCTGCATCACCACAGGCGGGCCAACCTTTGTCACCGTTTGAGTGGAATCTCCTACGA
TAAATACTGCTGGACCGGGTAAAGTCTGCACCTTTACAGTCTTAACAACCACAGAGGTCTGCGCGAAGGCATTCACGAGCTTCAAACCCACATGATACGC
TGCACCTGATTCCAGTAAGGACCCGTTCACTTTGAGCTGGAAATATCCCGCTGCGGTTGAATTCTGAGCCACCGCACGCAGGTAACAAGCCGATCGGAGT
TGTGCCATTGAGGCCAGCGTAGTTAAGTCCGATGAAGCAGCTGCAGCCAAGGTAAGGTCTCCTGCTGGAACATTGGTAGTACTGGACGTGCCAGTGGTCC
AGTCCGTCTTGTACTTTGGACACAGCACTGCAAGACCAGCTTCCAGTCTCTGGTAAAGTGCCAAACCTGCGTCTCCACTGGTTGGATCGATCGAACTGGG
ATATAATGAGGCTGGTAACGCGAACCACACCAACTGAGCGAACGGCCGACCGCCAGCACCACTTGAAAGTGATGCATCAGCGGTCCAAGTGCCACAGCTA
CCCGCATTTTCCGGAACAATAAGTACTCCACTGGGCTGAACGATCGAACTAGGAACCTGCACCGTAATTGTAGCTTGAGAGAACGCTCTACTGGAGGGAA
GAGCCCGAAGTACATCGGTAGCATTGCAGTATCCATCCGCTAACGACCTGCACTCGTTTAACACAAGTTTATCTCCGGCAGCTATCGTTGCTCCAGCACT
CAATTCAATGCGCAAGGTCACTCCATCCACCCACAAACAATCAGCTTGAGAACCTAAGACATACTTCACCCCAGCGAAATTGAACACCAGGCCACACGAA
AACGTTTTAAGTCGAGTCACGTACGTTCCAGACGTTCCAACGTCCATGGAGGCTGCATGGTACACGGAGGAGTCAAAGGCGACGACAATCCTAGCGCCTG
AGCTGTCGAACATAGCATTCACCGGTAGAGGCGGAGGAATCGCCTCCCTGTCGTTGATCATAACTGATACAGCCACGATGCTAATACTGCTGGGGACATT
ATACGCTGCATCAGGACTAGAGACGGAGTGAAGAACGCTCGAGAACTGATTCGCCGCCTCGGAAATCTCGTCATCAATAGCGAATACCGTCACGATCCGT
GGACGGAACCAATCCAAAGGCGTGAAAACCAGTTGGATACTCTGAATTATTTCCGTCCCCAGCGCCTTCATTCCCGAAGACGAAGAGGAGCCAAAAGAAG
TACCAACTTGAGGCTGACTGAAGGTTCCTTTTGAGTCCAGACTTACGATCTTTTCGATAGCAGGACGCAACATCACAGTAACGTTTGCGCACGGTTCCGA
GTTCAGATACACACGATAGGAATCATTAAAGCTTCCTTCAGCGACATGCAGCTGGTTTGTCGCACTTTGAAGCGAAACATTCACGAGCGACACGTCGTTG
TCGGTGATCAAGACCTTCACGTCCATCTTGTAGTCGCTCACAGTGTACAAAGGATCGGAACTCACTGACGAGTGCGAGAT