Description :
From Genome Similarity Track
Location :
Scaffold_25:121265- 126903
Transcript NameFunction/comments
Hyaar_Emoy2804018SFT2 family protein
Hyaar_Emoy2804019PREDICTED: vesicle transport protein SFT2B

Sequence
5638 bases(100 bases per row)
AGTAGCACGGAGCCAGATACTCTTCGTCCAGTGGTGAGTCTGGGCATATTTGAGCACGTTGTGAGCCCGAGCCGACCTGAAGAGCAAGAAGTCGACTACA
AGGTGATGGCCAGGGATTACGTCAAGATGGCTCGCTGGGACTACCGCAGTGGTAACAGGACTCCTAGTCAAGCGTCCTCTGTCCCCTGAATCAAATTGCT
CCGAGCGCGAGAGCAGCCCCGCCATCCGGTAGAGTGCACACAAGAATCTAACCCCGGACTTGGTCAACGGACGGTTTCCACGGGCCCTTTTGGGAGTGCC
CCGCCGTGACGCCCGACGTCTTGAGCCAGCAGAATGAGAAAGCTAGGAGTAGTAAGACTGTGTCATGGTAGATAACACGAGGTGGTTACCACACAACCAG
ACATCTCATTAGTGATTAGTAGCTATAATAGACAGTCTGAGCCTCTCTATCCTCACGGCTTTGCACCTCACGCGTCTTTTTTTCGTGACCATTGGAGTCG
CATCTCTTTCACACCAACTCCACGTCTATACCAATAGAAAGCCCATCCAATGAGTCTGGACAGCACTGCGTCATCCCCTGTGTCCATTGATCTGGTGTAA
CTTTTGGTCCAAAAGTGTGCACTGTTGAGGAAATGCTCTTGGTCGTATATAGACACATTTTGACCACCTCAGTGTCTCTCTTATGGCGTTAGTTTATTGG
AGTTCTAAATTGAGCCTTATATGATAGTACTGACAGGTACGGACATGACGCCGTAGGATTACAGATATCGTGCACGCCGTATGGTATCGTGCACGTGCCT
ACATGACGCAAGTGATTAAGAGCTGAAAAATAACGAAAGCTTATCGATTTAGTATCTGCTGCATCGATTGTAAACCTGCTGAAAAGCACGTATGAGGCCT
GCTATAGAACTACAAGTCGTACAACAACCGGACAAAGTCTGTGTTGTTGCCTTAAACAGCTGCGACGCACAGCTTATTCGCGATACCTGTAAGGACCTTG
CGTCCGTAAGGAATGTAGCTGGCCGAATACCTGTACCCGATATCCACATTTTCTTCTTAGTAAATATCCCAGTACGAAGCAGCCGTTGACGTTCGTACCA
GAGAGCTGCCAGACACTGGATGAATACTAGTAAAAGCACCACCAGTCCCAACTGCGGTGCCTGGAGAACACAATAAATACAACATTAATGTCATCCCTTA
CCCAATCAAGTTGTATCATCTGCCGCACCGCAACGGCCACGATAACCACCACTACAATCATCGCTAGATAAATGATTGTTGCGATTCGACGGATGGGCTT
GAGCATGAGCTTCACCTGCTGCGTTGGGCCAACAAGGAACCCCGAACTGGTTGCCATAAAAAAAGGTTACCGAACATTAGCAAGCATGAAATAAAGTCCA
CCGTCAACGAAACGTCATTACCCGCAGAGCGAAATGATATTGCCCAGCGTGTATGTAACGCCGAACTTGGCGCCGTTATTGCAGCTCAAAACCAAAGCAA
ACGTCGACTTCCAATAAATAAAAACGATAAAAAGCAAAAAAGCAATAAAAACAATAGCAAAAAGCAACAAAACGTGGCCATCCCCCTCATATCCGTTAGC
CGCAGTCTCTATCTCTCTCAACAATTATATGAATTATCAATAAGAATACCCCAAAGTTCACGAGATATCCGAGCACAAAGCACGACACAAAGCCAGTCAA
GCGCTGTTTCTTTGTGAGACTGGGACATGTGCTTTGATAAATCGAATCCGCCGACAATTCTCTCGGTGCCGTTTCGGGTGGAGAAGCCGTTTTCTTGTCG
CCCGTTAGACTCGCCAACTTTTTGCTGGCATCGCAGGCTGCGCCCGCCACTTTGTCGCCGGCCTCACTAATCACGATCTTCATTTGGTCCATCTTTTTTA
GTCTGTGTTAATTAAATACTCTGGGGTAGACTGACGAAAACGACGGTACGAAGCTAGATTATTCTTATGTAAAGGCATTGGTATTCTGTGAAATTCCGCT
GGAGAATATGTCAATGTCGGATCTGCACGAGGGACCATTGCTGTCATACTTTAAATTCGGTGGTGAATCAAGTGTAGTAATCGCTTTGATGCTGTCTCGT
CTGTGCTCGTGATAAAAAACTAAAGCTGGAGAAATTGAAGTGACCAGCATCTGTGCACTGTCCGCCTTGCACGAGCATAGTTGTGCTAATTTCTATGCTG
CCACAGCGGTGGATACGCAGCTTTCGGGAGTGCAAGGCGATGATAATCGTACTAAGCTGACTCAAGAGAGTGCTATCTACTGCAGCAATCATTTCTAAAT
TATTGTGACGCGCTATAATTTATCGATGTATGACAAAGTTTGCAAGTGGGTATGATGCAAGCTTTCGTTCGTTTCGTTGCAAGAGAGTAGAGTGGCTCCC
TTTAATGAATATGGGTTCAGCTGACGCACGTTTCAATAACCTCTCGTCGTGACAACTTATTGGTAAGTTGTAGCAATATAAATTAGCATTCATATGAATT
TGATCGATAGCGGACCGTGGTAAACAAAAGAAGCATCGGTATTCCACCAAGCTAAAAAAATCAGACCGAAAACTAACCCAAATTACTGCTTTCCCTTTGC
CTGCAAGCTCCTGGTTAGGTTTGGGTTGTGTCCAGCGACGTGAGACAGATTATTTATTCTGTTTCATGAGGTTTCATTTTTGTGGAGCGTAGTTGTGCTG
TAGATGGACAGTGTCTCAGTATAAATGACAATCTTCGTCGCGCATCACCGATGACCTGAATCTTGCCAATATCAAGGTCCACTCCGGTGGGGCAAAAGTA
GTGTTTGACATGCTTTCCCACCAGGTTGTGTGAGTCGTCTCTACGTCTTACGCGGCGATAGCTACGATTAACGAAGCTAGCTAAAAACCTGTGGCTTTGC
CTAGACCTAGCAGTTTGTACGTTACATGGAAAGTCTGAGGTGCATGGGCCGTAAGTCAGGTAGATGATCCTTCACCGACAAAATTCGCCTCCACTCGTGC
TGGCGTTGGATGCCAAGACACTAGAGATGCAGTCAAAAGGAAGATCGGCTATCAGTGACCGCATGGTCTCATCACTTACGGGAGTACATCATAACGGCGG
AGTGATTGCTAATACGGCGATGGACACTGAACGCATCTCGCAGGTTCGACTCGATAGGAGGGGTTTATTCAGACGACCAATGAACATACTCATGGATCAG
AAACAGTGGACGCTACGATATGACACCGCAAAATTGCTAAGGAATGCGGGCGCCGAACTAGAAAAGACCGCACAAAACAAAGTTGTAAGATGCTGGTGGA
TAGAGGCATCAGTAGAACGGACAAAGCAATTCGATGGCCTAGAAGTGATAAACGGTATCGACGCACGTCCCTGACACAAAACGAATGTCAAGTTTCATCC
TCCCTCCGACTAGGCAACGACCAAGGTCCTGGTGATGTATGCCACAATTTCGTTTCGTAAATGCAGCACTGCCGCCGCTACCATCTGCAGAAAGCGACCG
ATTGCGAAGAGGTTGGATCCCTTGGCTTGTAATGTGAGCATTCTTCCCTTCCAATAAACTTTTTATCATCGACAAAAGTATTGTTTTATAATTCCTGTTT
ATGCTGCAACGAGCCAAATTTGAGAAAATTTCCATCAAAACAATATAATTGCCCTTGTGCTTTGTACTTGTAACAGAGTGGCCACAGATCGAACTCGGTA
GACGCCAAATGAGTAACTGACCAGGGATTATAACCGAAGGAGGAGCACTGTACAAAGGTGAATGTGAACTTTATGTTGAGAATATTAGCTGTTTAAAAGT
ATTGTATATTTTGCATACTTTTGAAAATGCCCTGTACTGCCAGTGTTACGTTTCGCCCTGCGCAAATTAGTGCGATTTAGTTGTGTTCTATCTACTTGCT
GAATGATCTGCATATAACAATGCAAAATGCATGACCACATACGACATAGTATGGTTGCAATGTAGCGTGATTAGCCATCGATACTTGATGTAAGGTCCTG
ATTGTTAGCGGCTTGGGTGGCAGTCAAGCAAACTGCCATCGAGCAACATTGTGCAGTAGCGCATTCGTAACTTTCATCTCCGTCACTATGCACTACCGAA
GGCTGCAAATTCCCAGATAGTTACGGCTCTCATGCTTATATAACATCACTATCTCATTGCTCATCGTACCGTGTATATTTCAGTTCGTTGTTGTTGTCAG
GTAGAGATTTTAGCTGGCATTTGTAAGCTTGGATCACAACAAATCCGAGATAGGGGTAAAAATTGATACGAACACGGAAGTTAAGTAATTGTCGTGTTTT
CTTTCGGTCCTTAGTTTTGTTTAGATTCTACTCTCTGAAACTTTGTCATTGACTCTTGTACACATCCAGTTCTTACATCGCACGAGAATGTATTAAATTT
AAATTTGCTTCGAATTGGTGACACCAAAAAACAGAAAGACTGATTGCGAGCCCGAAGGGTGAAGCTATTAATGAGTGTGCGCAAGGTTGAATGCCGAACT
TTTAAATCGTACTGTGCGTGTCTGTCTATCTGTCTGTAAATAACGCGGTTAGGTGTACCTTAATCGTACCAAGTGCGAGCTAGTCTGCCCCCCCCGTAGG
TATAGGTATATCCGACGTCACTCTTTGGCTAGGTCACTATTGTGGTACAATAGTGACCTAGCCAAAGAGTGACTTCGGATGCTTGTAATTGGCTTAAAAT
TGATTATAGGTGAATATGATCACATAAGCAAATGCTGGACGCTCATAAGCAGAGGCCGATCGCGTTTGCCATAGCCTACTGTACTGGGTTAATACAGACA
TTAGCAGCATTGTACTCATTCTTCAGTGACTGCTATTGTATGGTATTTTGCATCTTGATTCAGGTCTCCAAACTGGATTACTTATATCAAAGGACAAGCT
CCAGAGCTTGCTCCTCTATCTTAGATCGTTTTCGAAAGTGGTTATAATAAAGAATTTTAAAAACAACGGTAATGTTTTGTCGAGTGAACTAATCTTCTAT
GCCATGCCTCACGTGCGGAAAAATACTCACGCAACGACACACGGGATGCAGCTGTACTAACATTGTCAGGATATATACGCACAACGTTTAGTTTTGAAGT
AGCACTTGTTGAATATTAAAATGCAACTCTTTTTGGTATGTCGCGTGAGCATAGATATCGTCCACCTTATCAGATTTTAGTACCGTGTTTTTCATATTTG
ATCAGACTGACAGCAAATCTGATTTCGTGCACGGCAGGACAGCTATAACAGCTAAAACGGAATACTACTAGACTAGAGCCCGTCGAGATGAAGGTAGCGT
TTCTATTTTATAAGCTGTGCAGTTATACCGGCTAGACCCAGTACAACGGATCAGAGCGGATGTCGCCTATGCAACCCAATGCCTACATTTATCAGGTCCG
TTAATTGTATCGATGTAAAGCATGTTTCTATGAAAATACGTCTCACACACAAACGAGATCAGTAGTCTTGCGAACCTCGCGATCCATTTCTAAGTTCGCA
TAATGCTGTGAACGGTAAGATAGCTAAAGAGAGGTACTGTCAAGAAAGGCAGTCTATGTTTTTGCACGTATCAGACATTATTAAAAAACCGACTATCGGA
AAACGTATGATAAAAGTACTAATATACGAAGCGGTCAA