Description :
From Genome Similarity Track
Location :
Scaffold_166:12126- 16953
Sequence
4827 bases(100 bases per row)
GAGGAAAAAGAAGATAAGAATCTCCTTTGTGCATTAGAGAGGTGGAAATGGCTTTGAACTCTACCATGCTCCAATCGGAGCCACAGCGAGTTGGGATGGC
TGTCTCAAAATTAAGTGGCCAAGCCAGAGAATGAGCTTTCACATGTGTACGTCAATAGACGAGGCTTTCCCCACATGGGATTTGCTAAAACAGCAAATAT
CCCGGGTGTTTGCTCTGCCTAATCAGGCATATCGAGTGCGTTCCCGCTTCCTATCTGCCCTTCAGAGCTAGAAAGAACTATTGGACTATGTCCAGGAGCT
GAGAACTTTAATCGCTGCCATGCAGCTTGATCCCTTACCAGAAATGGTTCTGGATACCATCTTCATGGAGGGTCTTCGTACTGGCATGTCTCGAACAGAA
GATTCCGAGTCCACCCCACCTCCTTTGACACGGCTGTGGATATCTCTTTGAACGCTGAGTTTAACTTTGAGACAGCCCGTTTTGGCACCCATAGGTACAA
CCCAAACTCGGCAAACTCATTTGGTTCATTCAATAGGCCTAGCCTATGGACCTACGTCTCGCCAAGACGCAAGAAGAAGCAGAGCTTCGAGCTGTATAAA
AAATTGAAACATTCGACGATGTTTCACGTGCAGAAGCACAAAGCATCTACAACCTAATTGCCTTTCACGCAGGGCACGCCAGGCTACTTCAAGTCGAACT
ACCGCCTCTAACCAGAAGTCTCGTATGGTGCGGGAAAACGTAGACCCCCAGTAGGCGCGGGACGCCTTGCTGGGGAGGAACTAGGTTCTTTTGAGCCTCT
AGGAGGTAGTGGCGAGCATAATTTAGCCCCAAGGAGTCCCGTGCACTCTGATACGGGGCGTGAATACAAGCCAGGCTTGTTGGTCGCAAAGGTGACTGTT
GAGGGCTTTGACAAATCCTGGTCGATTTTGATCGACCCCGAAGCATACGGTAATTATGTCAGACGCTATTCCCTTGAAGCGAATTAACGTTATGTTGGAG
AGCTAGAAGCGCACGGGGGTGATACGAAAACTGTTCGCTTGGCGACAAGAACTCTAGTCACTGAACCCAAAGTTCCTGTGAACTTGGGTGTGAAGTTTTT
CGATTTTGATAGTATCGAACGCTGTTTTGTCCTTGATTGGGACTTGAGATATGATCTCATCCTTGTTATGGCTTGGCTTGAGCGCCATGAGCCATGGATC
TATTGGAGGTTGAAAATATTAGGCGCCACGCGCACTGCCCCTAGCGGAGCTTTGTAGAGTCATTAACCCACCTCTGCTAGGAATCAGAAGCGCTATTGGT
GCGAGCCACTGGCTGACAATGTCAGTGTACTGGACATCGGGATGTCGGAATTAGTTGATTATGACGATGTCAAAGACATGAGTATGGGAAAATCTCGATA
TGTTATAGTGAAGCGGCACGTACTCCGCTAAGTGATAGTCGTTGTGAGAGCAATGTACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAGTTATCGAG
GGTTGAACCCATCAGATGAGCGTGGAGTGGCACGTAAGTACCCACTGAGTGAAGTTGGCCGTGATAGCGACGCACAGAATGTCAATATTGACGTTGTTGG
TGAAATACTAAGGCATCCCGAGCCCTCTCAGCGGATGCACGTGAAGTGGAACGTAATCCACGTGATGACGACATCATGTCCAATGAGTCGTCATTGGATG
TCAATAGTGAAGTCATCTCTAGTTTAGAGCAAATTACGTTCGATGATGGTATCGAGCAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGTGA
TGATGACTGTCAGATGTATACACTCCGTAACGGAGTGACTGGTGCCTTTGATGGTAAAACTAGCCTTGAGGCTATACCCTCGTTAAGTTTGTTTTTAGAA
CTCGAAGAGTTGTCGGCCGATGAGTTTGATCACTCACTAAAGAATGGAGACCTTTCAGAGGTGGTAGTCATTTGAGCCGACATCATAGAGTTGAACTCTT
CTTCACTTTTGGATGAAGCCGTTCTGGAGGACACAAAAGAAGCACTCAGTGCGCGTTGTGGGTCATCAATATTGAAAAACCCTCGTGATCCCTTTTATCC
TTTAGTCAAGAAACTTCAAGATGTGGTGTGCCACGATCCACCCTCGGTTCTACCTCCAGATAGAGGTGTCCGCCATGAAATTGACTTAAAACTGTGTCAC
ACGACAGTGGCCCTTGTCTAAGGAGCAATGCGATGTCATTGATGACTTCTTCCGTGCCAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCACTT
TTGACACCGACGTTTTGTGTCAAAAAGCCGAACGGCAAGTCACGTATTGTGCATGCTTACAACAAGATTAATGCGGCCATTATTACGGTACAGACAAAAA
TTCCTTGAAAGGATGTTCTCCAAAACAACATGGTTGGTTGTACTATGTATAGTGCACTCGACTTGGTCGATGTATATCATCAATTACTCATGCGAGAGAT
TGATATCCCGCTTACAGCAGTGATAACTCCAAGTGGTATGCTATAGAAATGGCTGGTGATGCCCCAAGGAGTTTATAATGCTCCGGCAACATTTAATCGT
CTGGTGACGCAACTTTTACGCCCACACAGGGATTACGCACAGACTTACTTTGATGCCATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTG
GAAATCACATCAGTCATTTACGAGCCGTGCTCGAATGCGTGCGCACTAATAAATTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGAAAAGATTCC
TTTTCTCGACTCTTTCATTGGTAAGCGCAGCCTCAGAGCGGATCCCACTAAGGTCAAAGATTTAGTGGACTGGCCGATTCCTAAGAATCGAAAGAACTTG
CGTAAGTGGCTTGGACTTGCTTACACAGATATAGTGAAACTTACGCTGATATGGCTCGGTCATTAGCTGATCTCCTTAAGAAGGACATCGATTGGCGCTA
GGACAACACTCACGCTAACGCATATCGGTCAATCAAGGAGAGTCCCCTCCATGCTCCCATCTTGGCGTTGCCAAATCCAGAGTACACTTTCAGTGTTGTC
TGCGACATTCGACTTTGCCATAGGCAGCGCTCTGTTACAAACAGATGATGCCGGCCGCGAGCGAGTTATCGCATTTAAATCACGTCAGCTCAAAGCTGCT
GAAAAGCACTATACAGTTCATGACAAAGAGCTACTTACTATGAAGTATGCGCTCGTTAAATTCAGAGTCCATATGCTTGGATTCAAGTCATTCGTTGTCT
ATACGGATCATGCTTCATTACACACGGCGACACAGTCACCTCACCTCTCTCATAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACGTTGAGGT
GAAGTACTAGCCAGGCGAACAAAATGTGTTGGCAGATGCCCTCTCTCGCCGTCCCGATTACGATCTTGCTCATGTCAATACTTTGTTGTCTCCTATTGAG
GAGTTAATTCGTATGGCATATCCACGGTATTTTTAATGCGTGGCATTGCTTGATGTCCTTCGGAGTGAGGAATACAAAGACTCGGATAGTCCGTTGTCGA
CACGGTTGCGTGCCAGCCTCCATAGATATTCCATCGATAATGGTCCCTTGTGCTATGGCATAGATGTTACGGATACCGCTCGTATTGTTGTACCTCACGA
TGAGGATCTAAAAATATCGAATCCCCTTTGGGGCACGTGACACTGCTCTCAGTCTGAATTAGTGACGGGAGATGACTTATGGCTATGTGAGTCAATACGA
ATGGTGGCCCAAACTCTACAAATGGGTGAGCACAAATACGTTCGTACATGCGAAACGTTCCAGCAGGTCAAACACTCGGCACACTCGGCTGCACCGCTCA
CTAGTTTGCCTGTGCCCACGGATTGTTGGGATTCCATCAGCATGGATTTAGTGTCCGGTCTCCCCAAAGACAGTGACAGCAGTACAAGAATTGTGCTCTT
TGTTGACCGTTTATGCATGATGGCTCACCTAGCGGCAGTGACGGACTCCATCGATGGTAAAGGTACATCTACGCTGTTTATCGATCGTGTGTTTCGTCAA
CACGAGTTGCCTCTGGCAATCATCTCCGATCTCGACCCTCGCTTTACGGAAACGTTTTGGACTCCCAACTTCAAGGTACTTGGCACGCGATTGGACATGT
CTACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCAATTTAATCGCGCCATCGGCGATATTCTTCGCAGTGTTTGTTCTGAGTCTCCACGGACACG
GAGCTCGATGCTCCCTGTCATTGAATTTGCGTTGAACAATGTTGTTCATGCCTCGACCGGCTTTACTCCCTTCTACGTAAATTTCCTCACGCACCCCCGC
GTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTGGTGGGGGAAATTCTGCTGACAAGCTTGATTAAATCATCCCTACCACGATGCAGAAACAATGAG
CGAGTTTCTCTCGACACGCTTTAGTGTCTTACGACGCGTGCGTGGTGCAATGGCTGATAGCCAGGACAAACAAAAAGAACAAGCTGATGCTAAGGGCAGA
GGATGTATTGATTATTATGATGTCGGAGACCAAGTCTTACTAAATGCTAAAAAATCCACCTACAAATGTAGTGTCTGCCGTCTTCAAGAAAAAGTTGCGC
CCACTCTTCATCGGGCCGTTCGCAATCATAGCGAAGAAGGGCATTGCCTATACACTCAATCTTCCGCGCAAGTTGCGCACACACCCAGTGTTTTACATTG
GCTTGCTGAAGCCATATCATGATTCTC