Description :
From Genome Similarity Track
Location :
Scaffold_718:12125- 13249
Sequence
1124 bases(100 bases per row)
ATGTCCACTGCGGATCATCCGCAGACAGACGGCCACAATCAGAGCGCGTCAGTCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACG
TACGTGGTCGTCGCAGCTTCTAGTTGTTGAGTTTGCGCTCAGCAACGCGGTGCACGCGTCCACGGGGTTCACGCAGTTTTACTTGAACGGCTTCCGCCAC
CCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGTGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGC
CAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAA
GGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGCTACTAGACACGAGGAACCTACCTCTAGACACTGTTAGC
TCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGA
CGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGA
GGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCAT
ACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTATGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTTCGGACGTGG
CAACAAAGCCTCGATCCGTCGGATCATGCAAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGC
TCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCTTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAA
GCACGAGGAGACGTTGACGGAGGT