Description :
From Genome Similarity Track
Location :
Scaffold_224:12121- 17520
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_224-abinit-gene-0.51Haloacid dehalogenase superfamily protein
Pytap_DAOMBR444maker-pag1_scaffold_224-fgenesh-gene-0.3Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.29Chromodomain-helicase-DNA-binding protein

Sequence
5399 bases(100 bases per row)
TGGCGTTGGCGATCAGAGACCACCGGCGCTGGTCGCTTGTCGTGTCACTACGAATCCCACACGCACGTTAGCGACTCCCCTTTGCTCCTGGCGCATGACT
TCTACATCAAAGATGCAGTACGAATGCCAGGGGACCATGCGACGACCGGAACGTACCGGTGGTGGCAGTCCTCGCGTCGATGAGGAACAGCTCTCGTGGA
GACGCGATTGCTCCTCGAGGACAACGAAACACGCGACAAGCGCGAGCTCTCTGGATGCGCAGCACACAGGCGGATGCAATGAGCTGCTTTGCGTTGCGGG
AGATGCGCTTGATGTCGAGATATCGCCGCGCAAAGTCACGACGgCCTAGTGCGATGCTGATGGGGATGGCGTTTCGCCCAACCTCCAGTGTGTTCGTTGT
GTTCACCGCTGGGGAGCGAGTTGTGACAAAAAGAGGGGGTGCATGTGGCcGgTGACGACCTGTTGATAGGATAAAATCATACCTcACTTTAAGTAATTCC
ACCAATGCGATGATGTTATTTATTGCGTATTGATATGATTGGCGGATAATAGGTCCAATCGTCATCCAATTGACAAGgCATGCGCcAACGGCTCATGTCT
GAGTGGAAATGGTGGTCAAAGGCCTGAACCTGCGCGGCGTGACCGAGTTCTGCCGCGCGTGGCTGCGGCAGCCAGAGCTGCTCCTGCCCCATGTATCTGT
GAAAGGTAaGAGCGCATTGGTGCTGCGAAGAAGCGCGACGTCGGCGTaTTCGTTGCGTCTCTACAGGCTGCGCAACTGCTCACCACGATTGGCATGCCAG
ATCTCAATGACATCTCGTTCCAGGCACTGCGTGACCGTGGCTtcAAGGGTGTCGTGTTCGACAAAGACAACACacTTACAGTGCCGCACCAGCGCGAGAT
TGCGCCACATCTCCAGGTATGTTGCgCCTTTGTTAACGCGTGAGGTGCAATCTGCTGAGGGTGCATGCCATTAGAAATCTCTGGAAGAATGCAAGCGCGT
CTTTGGTGACCGCGTGGTTATCTTCTCCAACTCGGCCGGTTCGAATGACGACGGGGgCTTCGTGAAGGCTGCAGAGATCGAGTCTGAGCTCCACGTCGCT
GTGTTGCGACACAATCAGAAGGTGTGTACTTTGATTTCCCAaTGTCGCCACGATGCTGGTgTGTGATGCGGACGTGTTCATGTCTTGTAGAAGCCCGACG
GCATCGATCACGTCAAGGCATATTTTGGTGCAGatGCTCAAGAGCTCGTCATGATCGGCGACCGGTACTCTACTGATGTGCTCTTCGGCAACCTTCACGG
TATGGTAGTGGTTCTTGGTTTCTCAATGATGTCCAAAGAAACTGAATGGATGTGCACAATCTCAtAGGCTTGTTGACCATACGCaCGGATCAGTTCACAC
ACGATGGCGAAAGCGTCATCAACATtcAGATGCAGAAGATCGAGAAGGCACTGATCGAGCGATTGGTGCGTGCAGGCGTCGTGGCACCGGACCACCCACT
ACTGGCGGACAAGCAGTCAATCAACGAGCTGTTGGTTGATGGCCCTGTCAAGGATGAGCGAGAGCATTAGACACAGCGTGGAGATAGAAAGAGACAGTGT
GGTTGTGTGTTGATATGTAGTAGCACACATCGGCCGTGTTCGTTGcTGGCATCCGCACTTGCAGGTgtAtaGGCCGGATGAAAGAAGTGTAAATGAGCGC
TAACGTGTAGCACACAGCCTCAACCGAAGCgaCAAATGCACAAGGTAAACTCAACACTACAaCCTTCACGTCTGTACACCGCGACGAGCGCTCGCCATGT
GCTCATGACGACGCACCGAGTAGTCGCATACCGTATGTTGAAGCCATGATACAAATTCCGCAATGCGAATCGACTGCCGACCGCCCTCATCCTTCCCTTT
GCCACACCTTCGTCgAGTCGgTACCATGCACATCGTTGCGGATCCAACTGGCCATCCAGACCGCCCTGCTGGCCATCACCGCCAATTACTCACCATCAGG
GGGgTTTCTTGGCACCCATCTGGAGCTCCCCATCTTCCACTTGTAGCTTCTCGTCATTCGACCAATCAAATCTCCCCAACTTAATCTAGCTTCTCTATGA
TTGGCTAGaTACtGAGCTTGAGGTTCAGAAACAACTCATCCAGAGTGATGGTGCAATGGTTGCACTTGCCCGAAATGGCCGTCGTCAAGTGGCTCCATTT
ACCCTAATGGAGATCACATGGTCGGGGTCGAGCACCtGTTTTCGCCGGCCGCTCTGACCAGACGGCGCCCGaagaGAGGCAGAGAGGATGGcGGgCGCGG
GCTTCCTCGTCTGtGTTAGTGCCGCCACgAGCATTCGCCTtCGGGTAGACACAGAGCCCAGTGCGCAGAGCAGAGCCCTTCACGAAGAGCGCCCAACCAT
CAGCTCCcGACGGCATCGTTCTTCCAAGATCGATTACGTGTGTGCGTgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGTCGCATTACC
CACGGCGGCCATCACACAGCCAGCGACGCCGGTACCATTCTTTACTGCTGCACCGCAGCAGTCCTCTTCATCaCCATTGAGGcGTCACTTCCTTTGAGCA
AGACCCTCGATGCCGTTGACTGTGTCCTTCCGTGGAGACGGTAAGAGCGACAGATCGAATGGGGATCGCAGAGAAGCAAGTGTCCTAAATAGCTCGAGCT
TGGTTTTGTTGTAGGCACGATCCGATCGACGCGTCCGTCGCAGCGCCGCCATGGACGCAAGCATGCGTCTTTCATCCCTCCGTCGACGATGCCTAAAACC
GGaGTCAAGTCaTCCAAACcGGAGACGCAAAGgaCCCACCAGCCCTCGGACCCATACCTTTGTGACTTTTACGACAACATTTGGGTTACCCCTGATGAAG
ACGCACAGGTCTTGACGCGCATTGCCACTGCCACAGGTGTGCGCACGGCACGGAAGCGTCGTCATTCGCAGCGCCAGCGACTGATCGACATCTCGCAAGT
CGCACACGTGCTCACTACGGTGCTTGACTTCAGAGCCGAGTATCCGCACTTCGCTTCGGAGCACAgTAATATTTGGGGAAGCAACGTACCATCGCAGTCG
AGCCAACAGGACGACGAAGACGAAGAACGTTCGCGAAACATCGTGTCCCCTATTCAAAGCCAGCGTCAGCGGGTACCTCAGTCAGCACCTCAACTCCGAG
CGAGCATGATAGAGGAGGCACTTACTGAACTGGCCAACGAAGAGGActCGGACGATGAACCCGACAATGAACCGGAGAAGGAGACCCTAGCACAGTATGA
gATCGCCGAGGCATCGTATGCCTCAAGCTCGGTGAGTGGCCTCAAGAGGGCCACAAGTCTCCCGATTGTCTCCATCAACGGTAAGACCAAGTCTCCATCC
AAGAAAAAaGGATCTTCGTCGTCGCTTCTCCCTCCATATCCACCAAGTATTGACACAGCGGTGCCACCTCCATCGACGAAGAATGGATCAGTCATCTTCT
CTTCGGTTTtCGTGGAGAaGCACGAGTGGAGctGGTCAATTCGTGTTCTTCTTGGcATCCACGAGCCTATTCGGCAcGCCCTGTATGTCATGGACCGATA
TTTGGAGCAGAGCCAGCGCCATCAGCAAGTCGAGACGCTGGAGCATCACACGAGTGAGTTCTTTACGTGGTTCAAGACGtACTTtGTGGAATATCTCAAG
TCCCAGCACGAgaTCAAAGTCAAAGTGCTTCACCCTCTAATCAAGCTCAAGCACTCGACAAAGCAAGAAATTCTGCGCACCTAcGACGAGATCTATGGAC
TACTAACGCAAATtcAGGAGCAAGAGAGAGGTCTCATGCCAGCCCGAGGGAgACAGAGCCTTGATCGCTCGGCGTGGCTGATaCGTCTTGATACCCTGCA
GAAGGCAATTCGTCGCCTCAACATGACTCTTCACTCCGTTCTCAACCTCGAGGAGAAGACCCTGCACCCAGCTATGTCGgCCGCATTCACTGAGAgAACA
TTCCAAAGCTACGTCATGCCGCGGCTCTTCCGTGGAATCAAAGCCAAGAAGGTCGTGGTACCGTGGATTGTGGAGCGTAGTAAGGTGTGGGGTGGTGAGG
CGGAGCAGAAAAGCTTCAAGGGgaTGCTGCCCATGACTTCACGcTTCCTATACAAGAAGATCTGGCGCCCATACTTCATGAGCAATGTCGCCGTCGCGAT
GAAGAACCTCAACGAGTTCGACCTCGCGACCGCTCATCCGCATGAGCGGCGTGAAGAGCACTTCGGATGCACCGTTCAGTAACTCGAAATCGAATgAGCC
TCAGCGTATTTATCCGGTCACATGAGACGGTAAGCAGGCAGATgAGTttAGCAGCTACACCTTGAACGAGAGTAAGTAAATGCACTTGAAAGATCTTGAA
CCTCTTGAGtAaaTCCACAAAACTGTTTCATTTGTTTtCGAGTACCCTGCTTACTACTCACcATCAGAGGCATCGTCCTTGGTGGACGGAGCGaGGGGCG
AAATGACAGCGAATGGCAGAgttttCTTGGTCGCTGTCGGCTTCCGCGAGCGCTTGCGACCAGTTgtGCGACTAGTCTCAACGGGTGGAGatGGCGGTAG
TGGCGAGTAGACACGTTTGaGAGCTCGAGATTGAGCTGGGGgCGCCTTTTGAGACTCTTTGGCTTCAGCATCTTCATTCGTCTGTTCATCAGCCTCTTCA
GTTTCATCCGCGGTTTGAGACTCCTCTTCGGGTACTGGCTGGCGGCGAGATCTGCTTCGGCTTGATCGAGAGCTTGATGCAGCGGCATCcTTTCGtGCTG
GAGCTTGGTCGTTTtCCTCAGCAGGCTGTCCTCGGTCCTTCTTCGCCGGGgTCGACTTCGCTGGTGGCACAGCAACCACGGTCTTGTTGGCCTCACCAC