Description :
From Genome Similarity Track
Location :
Scaffold_541:12121- 13808
Transcript NameFunction/comments
g11967.t1hypothetical protein

Sequence
1687 bases(100 bases per row)
GGTTGGTGACTGACGATCTCCACACTAGTGGAGGCCTTTGTGGGGTGCTCCTGGATGCTGACCCAGCGATTGCAGACGTGAATCTACCAGTGTCGACGAA
GCTGGGACTGGAGCCGCCGAACCCATTCCAGGACCCTGACCTGGCGTCGTTCCCACCATTTGTGCTCAGCCGAACGGTGGATGTACACTGGCAGAAGCAC
TGCACGGGAGTCTACCAGCAGCCTGTTGGTAAAGAAGGTGTAGGCGATGAGGACGATGGTATTGGCGGTGGTGGCACGATTGATGGTGGAAAGGTGAAAA
CGCAGGTTGTTGCGTACAAGACTGCGGTGACTGGAAGCGAGAGTGCGGCGTTGGAGGCGTTGACGCGAATGGGTCGTCCGCTGTGGTCGAGTGTCTTGAA
TTCGCCGATGGAAGAGAACGGCGTCGAAAGACCAACCACAAGAGGCGACGTGATCAACCTTGCAGCACAGAAGCTGTTGCTGGGATGCACAGTAGTGAGA
GGCAGCTACAACGAGCTCACCCTGTCCGGTGTTGCGTCTCTGCTGTGTCGACTGGGCCTGCGTCCGCATTGCAGCTTGGCTCTGGCGTCTCGCTCCGTCG
TCGACTTGATGGCCGTTCTCGCGTACGTGAACTTCGAGAAAGACGGCTGTCTGAGCACGTACGCGTCGGACCCAGTGCTAACGCTGGGCGCCACGAGAGT
GTGGTATGCCGTGGACGCAGCGCTGTCGAGGTATCTCCTGCCTCAGCTGAAGCGAATGCTGTTGGACGAATCGCTGGAGATAGGCGACAAGGGCCAAGTG
GTCGCTCGACTGTTGCTGCTTCTCGCGATGGACAAGTGCGTGGTGGGGGACACGAAGCCTTCAGAGTGCGAGTTCGTGGGCCAATTCATTCCTGTGCAGA
CCTTCATGGACGTGTTGGGCGTTGCTGACCTGCCGATCAAGTGCAAGGGAATGACGGCCGCAAGTGAAGCTACGAAGACGGCATTCAACGAGTGGCGATC
GCAGTGGGAAGGCTGGCACATGGGGTTCACTCACTTCGTGCAGCTGGAGGGCGAACCGAACGAAGAAACGCTTTGGGTCTTGCTGGGACGTCGAGCTGCA
GGAGTGCTGCCTCGCAGCCAGAAAGGAGCGAATTTGTTGATCCCGACTTTTAAGAAGAAGGACTCGACTGCAGAAGCCAAGGTGAATTCTCCCATTGACT
CGGAGGCTAAAGTGGGGGTGATTTTGATACAATTGACAAGCAGATCCCCACGCGACTGCGAGTCTGCAACGGAGAAGCTGTCGGTCGTGAGATCAGACGG
CAGGTCCGAGATTATTCGCATGTACATGAATGTACGAGAGGAAGCAAGGACCCACTTTCGGTTTGTCTATTGCGAGAGTTCAGCCAGGTGTGAGTGGGTC
AACGGCTGATACCAAGACAACCGCGACGTCTGAGGACGCGTTTGCGTTGTGTTTCCACTCAGTGAGCTGTGTGACGTACCCATTTCTAGAGGAAGGCGTT
GCCACTCAATTGGCAGGTCTGCTGACGTCTCGATGGGACCCCATGGCAAGTGTTGATGGCGGTTTGGAGCATCGCAATGAAGCGGAGCTGGCGTGGGGGG
AGGAGGAGAACGAAGCTGCTCTATCGGTAGTGATGCCGGACGAAGAGTTCAAGGGAGATTGCATCTCGAGTCCTTGCCCACGCACCA