Description :
From Genome Similarity Track
Location :
Scaffold_338:12120- 13208
Transcript NameFunction/comments
g10542.t1hypothetical protein

Sequence
1088 bases(100 bases per row)
GCAGCCAATTTGAACTGGTCCGCGGCCTCGACGAATGTCATGTCGCCCAGCTTCTCGTAGCTGAGTCCTGTCATCTCCTGAAACTTGCGAATGCGAAAAG
CCCGGGGTAACTTGCCCATGGTCAAACCTTCAGGGGACATCACCGTGTCGCCGTCGACGACATCCGCGTTCAGCTCTGGATCGGCCGTCATGCTGCGACG
GTTCCAGTTGGCCGAGCCAAAGGACAAGTACACGTCGTCAATGATCACGAGCTTCGTGTGAATAAGCAGCTTCCGGTCTGCCTTATATATGTAGCCTGCG
TTTGTGAACGCGTTTGTGTGCTCTTTCGTGACGACAATAAGGCGTTGGATTCGTGGCATCACCTCCATCAAAGCATCAAGCAGCTCGGGCACGTACACAA
AGTACTGCCGAGGCTCGCAGTGGTGTTGCTGCTGCCATAGTCCAGCGAGGGTATGTCCTCGTACGACGGATTTTCAAAGTCAAGCAGCTCGTCATCGAGA
CCTCGACATGGCAAATAGTCCGAGTTCCGGCGAGCTACGAAGTTGTTCGCGATATCCTTCGCTGCTGGTCCATGGATTCGGAGGTGGCCGTCCACCCAAC
CTTTATTGATGTATGTGATGTTTCCTGCGTCGCGAATGGCGGTGTTGTTATGGTACATGGTATCCCATCGATCAATGACGAGGTCGATGCCGCCCACGTA
TGCCACAGGCTGGTAGTGTCTGCCTGCGGAGGTGTTCGCCGCGATGACCAGCGTCTTCTGGTGGTGGGACGCTATAAGGTTGATGCGGTCGTCAAAAATG
TACAGCGCTCGGGCTCCGTTGATGGGGGACGGCGGGATACTGTTGATAGCGTTCCGAGCCTTGAAATTGTAGGGCATGTAGCCCCCGGCAATGCTCGCCC
AGCCCAGGATGTCTACGTTTCCACCTCGCTCCACAACGCCAGTGAACACTTCCTTGAACCCTGTTTTGGATCCTGTGGTGTCAACGTCAGGCTTGAGAGG
GGAGATGGCGGACAGCCACGTAGCAAGCATGACGCGGTCGGCTTCCTTGGTTGTGCTGAGGTCATCGTAGATTGCGTTGTAGAACTCG