Description :
From Genome Similarity Track
Location :
Scaffold_399:1212- 8796
Transcript NameFunction/comments
Hyaar_Emoy2814021hypothetical protein
Hyaar_Emoy2814022hypothetical protein
Hyaar_Emoy2814023putative mediator complex subunit 6
Hyaar_Emoy2814024hypothetical protein
Hyaar_Emoy2814025methylosome protein 50 putative
Hyaar_Emoy2814026CMGC/DYRK/DYRK2 protein kinase

Sequence
7584 bases(100 bases per row)
GCAGGTTATTGGTACAAAGTGTATTTGGAATCTGATGCTCGTTGCAGACCTGCCAGCATAAATAGGAGATCGAGTCGTTGGTAAAGCAAACGCTGCCGGG
GCCAAGGTTACTTGCATAAAAAAATCAGGAATCGCCAACGCTTCAATAGAACTTCGTGATAGGCTTCACCACGGCGCAGTGACCTTTGTCATCATCGACA
TGCTCAGAGTCGGATGAACAGCTCGTATTCAACTTGGCATAGATATCTCTCTTCTTCTCTTTGAGTCATAGCAGCAGCGTGCCTCAACTAGTAACAGTAA
CTAGTGGCCTTCACGGATATTTATGACCTCCGAAAAGCCTGGAATCGGCAGTTCGAGGACGTGCCAGAGCATATCTGACTCGCTGGTGTTCGCAGGGTTT
TGATTGCTCGTGTGTTCTACCTCACCAGCGCGTGCGATTTTTTCGCTCGTATTGTTGTACGTACTTTCCTCTGCATCCAGTTGCTGCGAGTCTTTCTTGC
AAGCGAGCTTACTGCATATCGTCACGTAGTGCGTTCGCACTCCACACTTATCTTTCGGAAGTCGAAGCTTGAAATGCTGCTTCGGAATAAACCCTGCAAC
ACGCACGGCTTGTCGATCCGCTAGCACTGCAACATGCAACTTTGTTGCCGGTAAGGCTCTAGAAGGAACAGTCACAAAACACCACATCATGAAAGCCCTG
CATGTTAGCATGTCCGCACACAGCCACACATATCTTCCTCACCTCGAAAAATGCTGCACAGAATGCACAAACAATGCGCGCATGCATTTTTGCGCACACA
AGTGCATTACTTTTTCTCTGGTCATAACCCGTGACGGCACCGTCATTGTCTCTGAGTCTTCAAGTGAGTCATCCGTCAGGCCACTGTGCACTGGCGAGGG
AACAGCACCAGACAGTAACACTTCTGCATCCTCCACATCTTCAAATTCGACAATGAAAACCTCGCGCGGACTGATTGTTGACGATCCAAACACGAGCGCC
ACTGCAATCGACAAAAGTCAGCATCGATCCTTTAGCCACATGTACACTAAATTCTCTTCACGTCCAACCCTCCACCCACCCCTCTTGACTTGCAGTGCAA
AAATAGCATCCAAGTGGACTCGAAACAACTGCTCAGCTGCCTCCACACACTTGACTGCCTTCTTGAGCCCTCCACGAAGCGGCAGCCTACCACCGACCAC
CGTCAGCACCACACAAAGAAGTAAAAATAACCACAATCAACAACGTCAACATAACCGCAAAAAAAAGATAACAGCAGTCATCAGTACCAACCTTTTTACA
TTTAATGGATCCATCTGCTTCTCCAGTCGAAAACGCTCGACAAATAGCAGCAGCTCCTCATACAAACTGCAAGTCATGATTGCACCACAAAACCAAAACA
AAAAGAGAGAGTCTCGACTCAGACTCTCTCAGCCAAGCCACACACACACACCTGATTCCACATCTTATTAAACATACATCACTAACGACGTACCACGGCA
CTTGGCCACGTATAAACAGCAAATACTTGACCAATTGGTTCACCACAAAAGCACGCAGTTCACGATCAAAGGCCGTTCGATACGTGACTCGGCATTCGGT
CATGTGTAAAAAAAGAGTCTTTTTTGATATTGCAATGCTCGACAAGAGGAAAAGTCGTCGTGCGTGATAAGTGCGCTTCGTCCTTGTTCAAACGTACTTG
AATAAAAAAAACCGACAAGCAACTTAACTCCAGCAACATACTAGCTAAACTACACGAGTTTTTGCGCAATCCAAACGCCGCATTTATCACCATAGTCTCT
CGAGTATCAACTATGGAAGTCGCAGCGCACGCGGACGACTACAACGCGTCGTTCCGCGACACCGTCTGGCTCCAGTCGTTCCCACTGAACCCGCAGACGG
TGCTGCACTACTTTGCCCTATCCCCGTTCTACGACCGCTCGTGCAACAACGAGCGCCTCAAGATGCAGCGATTAGGGCTCGACCAGCTCAAGAACTTGCG
CGGGATCGAGTACGAGCTCCTGCCGAACGCGGCCAAGCAGTTGCCCCAGCAGCTCTATGTCATCCGAAAGCAGCGACGGAGCAGCCGGACGCAGGTCGAG
CCGCTCGCGGTCTACTACGTGCTGGATGGTACCGTGTACCAGGCCCCAAATATCCACGCAATGCTGACGTCTCGCCTCGTAAGTTGCGTGTTGTGAGGTG
GTTTGAAGGTTGCGCAACTTGAGCTTGTTATTGTGTTTAAGAAGTTTATTGTGTTTGTGATTCTTGAAAAACAAAATGCTTGATAGAAAAAGTGCAGCTA
TCGCATCAATAAGGCGTTCCACGGGTTGGCAGCGGGTGTGCGGTTTAGCCCGACAGAGGGGTATGCGTGGGATTTCAGCTCCAAGGACAAGAAGGAGCCG
GTGATTCCGTCGGAGCGTACGTTGAGTATTGTTGGTTATTGATCAGTCTGTTTACTAGTGATAGATCACGTCAACTGACTTGTTGCCGTGTGTGTAGAGC
TGCAGCTGAAACTGAAGCAGAAGTACGAGAAGATGGAAAAGCAGCGCGAGAACTCGGCGCGCGTCGACTCGATCTTGATCCAACTCATGAAAAAACACGC
GCCGGAAATTGCCGAAAAGCTAGAGAACAACAATGCTGCAGCTGCCGCTCGAGCTGCAGGGCGAGAAGTTGCTGGGGTTGAAGGAGTGTCAACGGCGGGT
GTCGTTCCAACGCACGACAAGACCGAGTCTGCGAGTGCTGCGGCGGCCGTCAAGCGGCAGAAGGTTTCATGAACACATTCATCTCAATCTGAGCTCATAT
ACGAATGACAATATTCTCCATCCACTCTAATACGATTGTAGTCGATCAAGACTGATTTTCATATGGCAACCTGTTAGGAAATAAAATGTATGCAAGCAGT
CTGCCTGACTCGCCTCGTGTCTTCAACGCTATGCGGGAAAGCACAGCTCATCCGTCTTCTTCTCCTTACTGCTCCTTCTTATTCTCCACTTGGCCATACT
TGCTGCGCATTTGGTCCACCACGGCGCTTCCACGCTGCTTGCCATACTCAATCTTCTCCTCAAGGGTATCGGCGACCCCTTCCAGCTTCGACTTGATATG
GTCGCTCGATGGCATTTCGCGCGCCAGCGACTTGCCCGGCGTCCTCATCTTGTCCACGCTCGCCTGCCACTTCTTCGGGTAGCGACGACGCATCATCATC
AGCAAAAACAAGGCCAGCAACGGAAGCCCCACTATGGCCACGTGCCGCGCACAAATGCGGTCCGTCGGCAACGGCAAGCAATACTCGCGCTCGCCCACAT
TTTTGGCTGCTTCCGAGCTCTGGATCCACGTATCCTTGGCTTTATCACCTGCTGCGTGCATCGTGTCTCTGGCTTTGTCACTGGCCGCATACACCGTGTC
CTTAGCCTTGTCACTCGCTGCATTGACCGTATCCTTCGCTTTACCTCCTGCAGCGTGTACCTGCTGCGCGACTCGAGCTCTGACACTCTCCACGCGCTCA
CCCAAGTCACTGATTTCGGCACTCAACTTCTCGCTCGCCGTCTTGAGAGAGTCCATGACCTTTTCACTCATTGCATCCGTTGGCACCGGTGCCGAGTCGG
GCAGTCCAGCCGATTCACGAGCCGAGGCCGCTGCCTCGCGCATCACCTCATTCATATGGTCCATCTTGCCACGAGCATACTTGCCGAGGTTCCGTGCATC
TTCCTGGATCTGATCCAGAGTCCGACGGCCTTGGTCGCCCAAGTCCTTGCGATCACGCATCTGTTCCGCCTCCGTGAGCATTTCGTCCACCTTCGCGGAC
GCTGCTTCTTTCATGCCGCGGTCGTTGGAGCTCTTGGGCATACTCGTCGGCATTTGCATTATAGTGTAGGGAAAAAGTCGTGCTTTCGTCGGTCAGTTGG
TTGGTGTCGCTTGTAGTGCGCTAATTGGGAAGTGCTGTTGCTACAGAGCGACCGAGCGGGACGGCGAACGGATGCGAATTTGGGACGAGAGTGCACGGAC
ACCCACCATCGCAGTCGTTAACTGCCAAACGTGCCCATCAAAGAGCTCTTCAACGTCAATAGCGGCTGTTAAAACTAATAATGAAAGGTCGTAGATCTTT
CGTATGCGACATGGTCGACATGTACGCGAAGGGAGACGAACAGAAAAAAAGCAGCTACCAACCGGAACGAACCTAACGGATGGCGATACTTTTTTACACA
AGAGAAAACAAATGCTTTTTTTCTACTTCTTCTTCAATGGCCGACTTCAAGTGGCGGCCGTTACGCATCTTTTCAGCCAATCCGATCGCGCGACGCGATC
ACCAGTCGTCTCTCCTCTCGTTTGACCAGCATGAGGCATCCCGCTTACTCGTCACCTGCGCAGGTGGACGCTGTCGCTGCCTATGCGCTGCCTCACGCGC
TGTTTACGGACGTAGAAGAAGCCCATGATCAAGCGCATTCGAACGAGGGGTCGCTGCTAGCTATCGCCCAGTCGCAGCTCGAGGGAAACGTCTGGAACGG
CCATGTAACGCTAGTACAAGCTTCCCATACTAATGAACAGGTGTGTGGGCTGCAGCTGGACACTGGCGTGGGAGCTCTGGATTGGTGTGGTGCACATCAA
GACACTCTCGTGCTGGGCTGTGACGATGGCGACGTGCGGCTGGCGCAATTGGGCCGGACAGATGGGGCAGTGGCTTTGATACCGATTATTGGCGCTGCTG
GAGGCAGTACAGAGCAAGAGGATGCAGGGGTTAGAACAGGAAAAGGACACGATGATATTGTCACGGGTGTGAATGGCTCGCGTGTCTCAAAGACGCAGCT
GGCGACGTGCAGTTGGGACCTTACGTACGGTGCAATCGTGACGTTGGGGGAAGAGATGCTGCTGGTCAATTGGTAGTGCTAAAGGTGGCTTCTATGCTGT
GCTTTTTTGGACGTGGTTGTAGGGTGAAGTTGTGGGATATTGAAGCGATGAACGAGACGATCTCGACGCTTGAAGGTGCGTGGGATGGATTGAGTGTGAA
GGCTAGTTTGAGCGCTGTAAGTCTCATTACAGCGAGTGTTCTTTTGTGTGTTGAAGGTCATACGGATTTGATCTGGGACGTGGCAATGCACCCGACGCAT
GCACCTCTGCTATGCTCGGCGTCACAGGATATGACGGTGCAGCTGTGGGACGCTCGTCGTCCTCAAAGTGCGGCGTTGGTGGTGTCAACATTGCATTCTG
CGCTGTCGGTGGACTGGCACCCGACGCAGTCCACGGTGTTCTCGGTCGGTTTGGAGGACGGCACGGTGTGTACTTTTGACATACGCTCGCCGCACACGCC
GCTGGCTCGACGAGAGACGCATGGAGCAGCCGTGCACGTCGTGAAGTACTCGCCGTATCATGATGATCTGTTGGCGACGGGAGGGGACGATGGCAAGGCA
TTCGTGACTTCGGACGGCTTCTCGTCCGACCGCGCTGTGGGCAGAGAATTGCTTGTTGCCGAAGAGAAGGGTGCACCGCATCGAGACTACGTTCGTGCGT
TGGACTGGTTCAAGTCGTCGTCAGCCTCTGATGGCGAGAAGCTCGATACGATGCTTGCCACGGGTTCATGGGACAAGAGTGTGCACACGTGGGGTGTTGT
CGACTACACGGACCCTATTGCAGGCAAGCTACGTTCGCCCGCGATATCTGAGACAACGATGACAGCAGCTCTTCCAGACGTACCTGTCGCGTAACATGCT
ACAATACGATGCTCAAGTGTTGGAAAAAAATGCGTCGTTGACAAATGCTCGGTTACGATCTAGAAGTTAAGTTCTACAATGCCGCGTTGCATCCATGGTT
CTTCCAGCGCTTGCTCTGCAGTAAGACGCTGACTGGGGTCCCAGACGAAGCACTTGACCAAAAAGAGCAAGAACTCCGAGTCATCGGTCATCACCACACT
AGCCAAGCTTCGAGAACCAGGTATGCGTCGACGTCCGCGTGAGTTAATAAATGGCTTCAGCACGTACTCTGCAGACTCGACATCAGCAGGGTTTGAGACT
TCATCGAAAAAGTTCAGACGTCGCTTTGCCTGGAGGACCATATCAACTGGAGGGACACCGAGCACCTCCATGATGCAATCGAATTGCTCGCGCTCATTTT
CACCAGCAAAAATCGGGTGACCTGTCAGTAGTTCCACTAGGATGCACGCCAAACTCCACATATCGATGGTTTCCGAGCAAACGTGGCCGAGCAGTACTTC
AGGACTGCGGTAAAACCGGCTCTGGATGTACGCGGCCACGGGAGCTCCATCCAGACTACTGCTACCGAAATCAATGACCGTCACCTTGTCCACGGTATCC
GTACAGCGTGCGTCGTTCGCCAACACTGACGCATCAAGCAAGATATTCTCCGGCTTCAGGTCGCAGTGAACCACCTTCTCTTGTTTCAAGAACGTCAGTG
CTCGTGCCAGTTGCTTACCCACCGTGCGGACGCTGTCCATGGAAACCCCGCGAAAGGATCGGATCGATAAATAATGGTACAAGGTCATGCCGAGCTCCTC
AAAGACGATGCACACGTGGTCTCGAAACTCAAAGTGGTCTTCCATGCAGACAACATGCGGATGCTCAGGACAAGCTGCTGCTCCACGCTGGAGCTGAGCT
AAAACCTGCACCTCCATCATTGCCTGGTCACGATACGCTCGTCGATTGCGGACAATCTTCACTGCAACTTGTCTGCGCGTGCGGTGATCCACACAACGAA
CAACCTGGCCAAATGCTCCTTGGCCTAAAGCACTCAGCACTTCGTACCGAAATGCCAAGTGGTCTCCAATCAAGACGAGATAATCTCCATCCTTGTCGTC
GTAGCCATCATTGTGCAACTGCGTAAGCACCTCGTTCGGGTCTTCAGCTTCCACTTCCAGTGGTTCATCGCCGTGGACTGGCATTATATTCCGGATACGT
CCATTGCAACGAGCTCGCTTGACTGCAAGTGTCGATACAAAGTAGACCTCGTCATACTGCTGGATCTCCACGCACTCGAGTCCCGTCAGCTCAGCAGCTT
TCGCCATATCCCTTAAAACCAACTCCTTCCCAGTCAAAGGACATTTCGTCAATAGCTTCCTGGTCTCCGATACGTCCTGTAAACGGCACTTGTGCTTTTT
CTGCTCTGTTTCTGCATCTTTCACCGCTCCTGCAAGCTGCAGTCTTCGCTGTAAATAGGGTCTCGACTCCTCTTTGGTCTTGCTCTTGTCCTTGAGCTGC
TGCCGTCGTGATCGACCATGAGGCTTTTCACTATTGTGGAGACGACAAGAAGGTCGATACAGACGCTCGTCCCCTGAGAGACCTGCCGTTGCACTGACTC
TTGACTCTCTAGCTGACCGATCACTCCCTTCCGATGTCAGCAATGAGCTCGTCGTGCGCCGGATCAAGTCCAGCGGTCGTCGATTGAAGAAAACGTGAGC
AATGGAAGGTGATGGTAGAGTTCGTGACCGACTCGAGCTATTGCTATTGTAAGTAGGTTGAGGTTGAGGCTGATTACCAAGCTGCTCGAGCTTATGTGGT
GCAGCAGCAGGCGAGCTGGACCGGAAGGAAGCTGGTGTCAATGCAGGCAATTGACGCTGCGTTCGTCGAGTGGAACAGGACGAG