Description :
From Genome Similarity Track
Location :
Scaffold_1586:1212- 4898
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1586-snap-gene-0.1Gene of unknown function
Pytar_ATCC12531maker-par_contig_1586-snap-gene-0.2Reverse transcriptase

Sequence
3686 bases(100 bases per row)
CGGCCTTCGCGCGTGATCACCTTACGCCGGGCGAAGCCTGCGTTCACTTCCACGAGTTGATGACGAAGAAAGCATTCATCTGGTTGCGCCAACTGCCGAT
GAACGTGAAGACCGACTGGAAGCTCCTCCAAGAAGCGTTTGAAAGAGAATACTGCGGCGCGTCTACGACCCCGCAGCAGAAGTGCTACACCCTCAAGCGC
AAGTCGGACGAGACGGCGCTCGACTACCTGTACCGCCTTAACGTGCAGGCGATCGAGGCGAAGATCGACTTCCAGGGTGCCGACGGCGGCTTCCACGTGA
AGCACTTCATCGACACGTGTGATGATCATGATCTGGCTCGCTCGCTTGGACTCGCGAAGGTGAAGACCGAGGAAGAACTACGCGAAACACTCAAGGAGCT
CATGCGCCAAGAGCAGCGTGCGAAGCGCGACGACCCGCCGAAGGTGCGTTTTGACAGGCGCGACGTGAAGACAAGCAAGCCGCCGCCGTTTGGCTCAAGG
TCGCGGCCGATCACCGTGGACGCGCTCGCGAGGCAGCGTGTCTATGAAGATGCTGTTAACGATTGGGAGCCGGACGGAGAAGACGATGCTGACTGCGACA
GTGAGTACGAGGCGAGCGATGATGGACGCGAAGACGAAGTGATTGCCAAACTGGTTGAGAAGACCAACTTGCCGCTCGAGACAATGCAGGCGATCGCTGC
AGTCGTGGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGCCGTCGCAGAAGTCGTTCCTGCAAGGCGAGT
TCCGACATCGTCCAAGGTGCCCTCAATGTGGGATGCGCCACGGCGAACACGAATGCCGCGGTGCTATCACTTGCACGGTCTGCGGGATCAATCAACGCGA
TATTGGGCTGTGACTTCTTGACGCCGGCCGGGATTCGCCTCGACTTGGCCGATGGAGTCGCTCTGATGCCCGACGAGATCCGAGTCCAGTTCGAGGGACG
TCGACCACACTACAGTGACAAGGCGGAACAAGTCAGAACGCGGTCTGGTGAAGCGGCTCAAGTTGACTTGCATCTTCGATAAGCCGGTCACGATCGCGTC
GCAGACAGTCGTCGGGATGTGGTTGCCNNNNNNNNNNACTCGAGACGCGTCGCATCGCCGCTGCTGAAGCCGAACTAGCGCGTATGCCGCCTGCCGTTGA
GCGTAGCACCTACNNNNNNNNNNCCGCGTGCTGCTGGCTACGTCTCGGTCGGGTCGAGGAGATACGAAGAGTGGTGCACGCTCACGTACGAGGCCGAGCC
GGAGCCGNNNNNNNNNNACACCGCGTGCGATTCTTGTGCGGCCGTCGAGTGAAGCTCGTGTGAATGGAGGTCGTGGAGTGCGGCCGACGTCGGAACGAAG
TGCCGGCGACCAGGGAACGAGCGAGCGTGAAGGTGATGGGCCGCCAGGAACGTGTTCAAGGAGTGAGGTTGTCGCAAGCGTGAGAAACAGTGCGGGCGAT
ATGTCCAGTGGAGGCTCACGTGGGACTCGCTGTGACAACACCGAGTCTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCATC
GCTTTTGTCGAAGCCAAGTCGCTGATGGATATGAAGATCGACGAGACAAGTCTGTGAGACGCCGTGTATGTCCACGAAGGTGGAGATCTGTCGGTGGAAG
AGATCGAGGGTCAAATGGTTCTCATCCCAGAGATCGATCCCACGGACGATATCACTCCAGAGGATATCCAGATCGCTGTCGGAGAAGACGTGCCTAAAGA
AGATGTTGAGCGAGTCCGCGAGATAATCTGGCGAAGGCGAAAGTATCTGATGGGCAAGGGCAATGCGAAGCCGCCAGCAGCCAAGGGCGTCGTCTGCGAT
ATCGACGTGGGCGATACTAAGCCGGTAGCACAGTCCTGTCGGAAGGTGCCACCCCAATACGTTGAGAAGCTGTACGAGCTCCTCAAGGGTTTGCTTCGCC
ACGAGTTCATCCAACCCTCGACATCGCCTTGGGCGTCTCCCATCGTCATTGTCGTCAAGAAGAACGGGATCGACATCAGACTCTGTATTGATTATCGCGT
CGTCAATGCGCTGACACGCTTGATGATCTATCCAATGCCGGTGGTGCACGATCTCCTCGAAAACCTGGGCAGTCTGCTTTGGCTTTGCTTACTCGACATG
GCAAGCGGCTTCTGGGTCGTGAAGATGACGGCACGAGCACGCGCGATCTCGGCATTCGTGACTCCATTCGGCTTGTTCGAGTAGCTCCGCATGCCATTCG
GCTTAAAGAATGCTCCTCAGATTTATCAGTGCTTACTGGACAATGCACTCTACGGCTACCTGAAGCTCACACCGAAGCACTTGCAAGATGACGAAGCCGA
TGTGTTCGTCGACGGCAAGGCGGCTGGGACGGATGTGCGACCAGCGATCGGGAGACGCTCCTACATTGACGACATTCTTTTCGGCGGCTCAACGTGGGAT
GAGATGTGTGAGCGCCTCGAACGACTGATGGATGCGTGCGAAGAATGGGGTCTCTCTATTAGTCTGCCTAAAAGCCAATTCGGGATGAGTCGCGTCGAGT
ACCTGGGTCACGCTGTATCGGCTCGAGGAGTCGAGGCCACGCCAAAGAACTTGGAGGCGCTGACACAGATCGCCTTTCCGAAGACCGTCAAGGCCGTGCA
GTCCTTCCTGGGGTCGCTCAACTACTACCACCAGTTCGTAGAACACTTCGCGGTGTACGCGGCGTCACTGTACGAGATCTCGCAAGCGGATCTGGCGAAG
GAAGCGTCGGAGCCTGGTCACCTCAAGGCAGCTCGAGTCGCGCTCGACGAGTTGAAGCGCAAGATCGGAGCAACACCGGTCCTGAGGCACTTCGAGCCTG
AACGTGAAGCGATCCTCGTCGTCTACGCGAATGACTGGGCCGTGGCGAGTACACTTGTGCAAGAGACCGAGGGTCAACTCAAGCCGGTGAAGTTCTACAG
CCGCGTCCTCAAGGCGCACGAGATGAAGCTGTCGCCTGCCGAGAAGGAGATCCTTGCGGCGCTGCAAGCAACTCGCGAGTATAACGCGGCCGCCGACTGT
CACAGGGAAGGCGCTGCAACGCGGACGTGGTGAGGTGGTGACGGCGGACGAGCATCACAGCTTGGCGACGCTGAATCAACTGCAAGAAGTACTGCGCGGA
CCGAGCGTGCAGTGTGCGACGTCGGTGGTCGGCGTCACGACTCGAAGTGGGCGACGAACAGGAGATGCCGAAACTCTGCCCGGACGAAATGCGACTCTTC
ACGGGACTGGTGTAGCGACACCACGTCTCGGTGAATGTGTGCAAGACGACCCATCTCCGCTCACGACATCGCCTGATGACCGTGTGAGCGACAGGCGGTC
TGGTCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGTGCCAGAGACGGTCCATCCGATGAATCCAGTGATGTGCGTTTAAGCGACCCCCAGCG
TCACGCGTCGAATGGTGACGCGAACATAGACGGTCCAGACCATTCAAATCTGACTGTTGAGGCGATGGGACGAGGTAACGACGAAGTGCAACCCGATCGA
TCGAGGGACACCAACGCAAGAAGACGTCATTCAGCGCGTGCGAGCAGAGAGGATCGAACGTGCACAAGAAGAAGAAACATGGATCA