Description :
From Genome Similarity Track
Location :
Scaffold_541:12116- 13537
Transcript NameFunction/comments
g11967.t1hypothetical protein

Sequence
1421 bases(100 bases per row)
TCTCGGGTTGGTGACTGACGATCTCCACACTAGTGGAGGCCTTTGTGGGGTGCTCCTGGATGCTGACCCAGCGATTGCAGACGTGAATCTACCAGTGTCG
ACGAAGCTGGGACTGGAGCCGCCGAACCCATTCCAGGACCCTGACCTGGCGTCGTTCCCACCATTTGTGCTCAGCCGAACGGTGGATGTACACTGGCAGA
AGCACTGCACGGGAGTCTACCAGCAGCCTGTTGGTAAAGAAGGTGTAGGCGATGAGGACGATGGTATTGGCGGTGGTGGCACGATTGATGGTGGAAAGGT
GAAAACGCAGGTTGTTGCGTACAAGACTGCGGTGACTGGAAGCGAGAGTGCGGCGTTGGAGGCGTTGACGCGAATGGGTCGTCCGCTGTGGTCGAGTGTC
TTGAATTCGCCGATGGAAGAGAACGGCGTCGAAAGACCAACCACAAGAGGCGACGTGATCAACCTTGCAGCACAGAAGCTGTTGCTGGGATGCACAGTAG
TGAGAGGCAGCTACAACGAGCTCACCCTGTCCGGTGTTGCGTCTCTGCTGTGTCGACTGGGCCTGCGTCCGCATTGCAGCTTGGCTCTGGCGTCTCGCTC
CGTCGTCGACTTGATGGCCGTTCTCGCGTACGTGAACTTCGAGAAAGACGGCTGTCTGAGCACGTACGCGTCGGACCCAGTGCTAACGCTGGGCGCCACG
AGAGTGTGGTATGCCGTGGACGCAGCGCTGTCGAGGTATCTCCTGCCTCAGCTGAAGCGAATGCTGTTGGACGAATCGCTGGAGATAGGCGACAAGGGCC
AAGTGGTCGCTCGACTGTTGCTGCTTCTCGCGATGGACAAGTGCGTGGTGGGGGACACGAAGCCTTCAGAGTGCGAGTTCGTGGGCCAATTCATTCCTGT
GCAGACCTTCATGGACGTGTTGGGCGTTGCTGACCTGCCGATCAAGTGCAAGGGAATGACGGCCGCAAGTGAAGCTACGAAGACGGCATTCAACGAGTGG
CGATCGCAGTGGGAAGGCTGGCACATGGGGTTCACTCACTTCGTGCAGCTGGAGGGCGAACCGAACGAAGAAACGCTTTGGGTCTTGCTGGGACGTCGAG
CTGCAGGAGTGCTGCCTCGCAGCCAGAAAGGAGCGAATTTGTTGATCCCGACTTTTAAGAAGAAGGACTCGACTGCAGAAGCCAAGGTGAATTCTCCCAT
TGACTCGGAGGCTAAAGTGGGGGTGATTTTGATACAATTGACAAGCAGATCCCCACGCGACTGCGAGTCTGCAACGGAGAAGCTGTCGGTCGTGAGATCA
GACGGCAGGTCCGAGATTATTCGCATGTACATGAATGTACGAGAGGAAGCAAGGACCCACTTTCGGTTTGTCTATTGCGAGAGTTCAGCCAGGTGTGAGT
GGGTCAACGGCTGATACCAAG