Description :
From Genome Similarity Track
Location :
Scaffold_116:12116- 13121
Transcript NameFunction/comments
Phyag_g2283hypothetical protein

Sequence
1005 bases(100 bases per row)
AACGTCCCGCTGGCCTTTAGCACGTTCAGTTCGCAGTCGCGACCCAGACTCGACTTGCAgtcgctcgctgtcgttggcaCAAAGAAGTTtccgtcctcgt
catccagATTGGGCGTCGTCACCGTATCGAAGTAGTTGCCCTCCGCTACCACGTATGAGCTGATTGCCACGTCGAACGAATGACCCGAGTTGTCGTAGAA
GTAGTTGTTGGCGGCATGCACCACAACACTCTGGTCGGCTGTACCGCCGATCTTTGGAGAACGGCCTGACGTCTCATGGATGTAGTTGTTCACGAGGCTg
atctgcgtcgtctcgcCGTACAACAAGAAGCCCCAGTAGTGGCGACCATCGCACGATGCTGAGTACTCCGTGTTGCCGTCGAAGTCCGAGTTGCTGATGG
TGAGGCCCATTGCGCCCGAGAAATTGACGACGACCATTTGACGGCCGATGCTAGAGACTTTTACGTGGTCGACCCAGATGCCGGACGGTGCTGTGTCACC
GGACCCGCGAATTGTGATGGCGTCGCCGCCCCACACGAGATGTGGATTGAGCTCGGTGATGTGGATGTTCTGCACAATGACGTTACTGCCGGTGATCAAG
AGGCCCTTGCCGTACAGCACGCCGGACGTGCCCTCTCCAACCAAGGTTTTATTGCTGGCCACGACGAGCGGGTTCTTAGCGGCGTTGTCGTATGTCACCT
CGACCGAGATGCCATCGCTATCACAGCCGCCGGTTTTGGACATGGCGGTATCGCCGTCCATGAGAATGACGTCCTGGGACTTGTACCCGTTGTTCTTCGC
GATGCATTGTTGGTTGAAGGTGGGTCTGCATCCTGTCTCGGTGGTGGATCCTTCTGTGCCGGAGAAGTTGAacgtttgctgcagcacgatgaCTCGGggt
tcgtcgtcgctgaggTAGGTGGACAATTCGTCGGCAGTAGTGGGGTAGACCGGTTCGACACTGCCACCGCCTGtggtaccagcagcaaagccaGTAGCTG
ATCCG