Description :
From Genome Similarity Track
Location :
Scaffold_79:121130- 134687
Transcript NameFunction/comments
Phyca_LT1534128924protein kinase, putative
Phyca_LT1534511235protein kinase, putative
Phyca_LT1534128894myosinlike protein putative
Phyca_LT153483452myosin-like protein
Phyca_LT1534511237Hypothetical protein
Phyca_LT1534511240Hypothetical protein

Sequence
13557 bases(100 bases per row)
ggagtccagactggacaatcggcgcactttggatagtcgcggcagtagaatctacggtttgtgcaagatacacgtacagactccgcccagaaactgaaaa
gggtggaccttcaaagttcccccaggttataaattatgtaccggatatgtaacatcacatgcaaatgtctcacatttatttgtcaaattaaaacgtcgct
cattctcactttgtgtcgacgcgtggggggagtgttgttctccttcacctctgaaaatacaatcccgctcttcataaagcagtggcgaattttctctgga
gtgatatcgccccacgcttcgtcaacccacttcattccttgcaattggtcaacgtagtagataccttttccctccggagccttgtgtggcatcgacttgt
cagccctattgcacgccaaactcatgtgcctatcgcgataaccactatttgctgccgcaataattccggcgtccattggctgaagatatgatgtagtgtt
tggcggcaacttctgcacagtgatgttggtgagctcaccgctggctcgtcataatacgctgggccttcttcgcaatgagccgacgagaaagacagacatg
agcactctgacactctatcacaaactcgccaagctggatctcaagctccgggcagcgtacacgagatatccgtcctttagcggtggtacgtagcagattg
aagcttagccttgatggtggctgcgtcccgcaggactcgaaagattgtagcatcggctggaggttgcgagagctcgaacgcatgtagcgcccagcgcccc
aattcggacagtgtcagggagggacagcgacaatgtttttcaataaccttgcacttctggttgatagttagccagagaccttttgcctttcgtcatgttc
tgctctgctcgaagacgtgcaattggggggagaattcgaaatttgaacagttagtgtgaaccacattggcgtgagacagacaccacctcctgaatatgct
tagcctgatacagccgattttgaaaggttataagcaggaggtagttttcagtttctgggcggagtctgtacaacttgtgagaaccattcaacagacctgc
gtttgagctcgaggcgcgtactatggcgtaacgatttttggcttcatatccaacccacataatgctgttgccgtgaagggtcaagaagcaggttgatggt
cagacgttccgccgacataatttccaatttcagcaggataggttcattggagacttgtggcgcgttcaacggcttgatttcttctttctcgtcaccctca
agccgtcacaaatggaggctgttgaaatcttctcgggcgaaaactgtgccgggacgccggacgtgttggccatgtacaacgtcactgcttcctgtgtcga
agacaagtgcagcgacatcgactttggcaacgaaacgtacttcatgagtcgaacctgcgatgtaccagaccggttcgcacataccaaggagattttcgga
gacttcgactacgtgatcatggagacgtacgacaacgagagctgcatgtcgttcggggaggcggacgtctttccggcatccggacggtgtgagatctcgt
ccggattcggagatcaatcggccatcaccaggttattcaccaatggctcagctctcgtggtgctgtatccgaacggcgcatgtggaggcgaaccttcatt
gtatttcgaacttgataaggcagcactggctacgggatcttgccagcaaagtctctaccggttttacagcagtgacagtagttccaacatagcatcaggc
tctacaagttcgagcaaagaagagagtgatagtggcagtatggatatgtttgatcctcaagagaacagctcgtcaggattggataatggagtcaagatgt
cgaccgattccagcattggcactggagtgattgttgggattgcagtcgcggctttggcgtttgtactggtcgtggcactgcttgtaaagtggcatcttgg
taaaaagcacgaagatgaaacggaaagggacgacgacttcaccgccttcagatctcctcgagctggtcggaaaaacgagtcggtaacagaggacaaaact
ctggattcaccttggattgacggccacagtagcggacaaaaacctctcagtctcgtggggttatgggacgatgaagtcatcgctacagctcggatcccca
gagagaaagtggttattcagcaacaaatcaaccgtggaggaggaggagaagtatatctcggacttttcaatgaacagcaagtggcagtgaaaatgctact
ccctgaaatgcgcaaaagtgttaaacatgtgaacgctttcttggccgaagtgaagctcatggcaacactagatcaccctcggatcgtgcaattcgttgga
gtagcttgggattctcttacagatttgtgtgtcgtctcggaattcatggaaggaggcgatttaagagaactattgacaatttacgaaaaggagaaacagc
ctacaggtttcgaccgaacgaaagtgacgatcgctttgcacgtagcccacgctctcacttatctccactcactggagacgcccgtgcttcatcgagattt
aaagtccaagaacgttctattgacatccgatctcgaagcgaaacttacagatttcggaatttctcgagaacaagtcgatagaacaatgacggcaggtgta
ggaacttctctgtggatggctccagaggtgatgctaggggaaagatacgacgacaaggccgacatgttctcgttcggggttttactgtccgagttggacg
tgcacacaattccgtactcgcacgcaaaggacaacagtgattcggatcgaaaaatgcccgaaacagtcattttgcagatggttgcgctagggaaactacg
ggtagagttctcttccaactctttagagtcgatggtggcgttaggcttagcgtgtgtgtccctggacacaaaggagcgaccaactgcagctgaagcactc
tacaaactgcacacgatcctttcgcaagaactataggcacgtacattttgcaagttagggtacatgtgcaaattttatacacttgcaaatttgcaaggtg
caatccgaggtagtgaaccattttgccacttgaattctcttcctgccctgtctgctcctttgccatagtgaaattcagtgtctaaactgaacaaattctg
tgggaatttagccatgtggtgcatttgccacaagtgaattggcaagatgcacgccaccttggcgctgtcctttgcgatggcagctaccgttaccgccgac
tccgtcatgcgcggcttcagcgtcttcgagaacaacaactgcgttggaactccattgattttgtccatggcaatcgaagcggattgcaaaatcggacttg
tgacgaaatggcttttggcgatgaaacctactacgtctccaaaacgtgcaacatctcggatcgattcgagtacgcacgcagttcgttcagtgacgtgtct
acttatgtcgttcttgagaattatactgattctggatgtgaaaacctcgatgaaacactagcgttagtggcaactggcaggtgccaagtgggtgatagtc
ttgggacaaaatctttcattgccaatctctactcgaataactcgttttcaattgactactaccataatgtttcgtgtggaggagagagttatcatggggg
gactgcaaccagtgtcaacgtttcaagaggtgactgcatcgctccagactacagagtttacgccagtatctatcttaacgctgagtccaccagcgcaagc
gacagcacaagttcagctccttcgagtagtggtgatgtcgccacagttgtaacaaccagttcaggcattggtacaggaacaattgtgggaattgccgttg
ctgtggtagttgtagcgctcttcattcttggattcgtgtggtaccggaagagaaacaaaaaaacttccgaagaaaacggatacgggaaagtggactctcc
gacgttagaccccaagacggacgaatcgggtgaagcagattttgctctcggaccccaagctctggcaggactttggaacgatgaagatatcgctgctgct
cgtattcctcgtgaaaaagtggaagtccagcatttgatcagtcgaggtggctacggtgaagtctactacggccttttcatcgggacaccggtagccatca
agatgttgcttccccatttacgtaagagcgtcaagcacgtgaacgattttctggacgaagtgaaattactgcaaagactggatcacccgcatgtcgtgca
gttcgtcggtattgcatgggacactctggctgacttgtgttttgccttggaatacatggaaggcggcgatctccgtgctcttctcgtatcctacgaagcg
cagaacgtcccaatgggtttcgacaggaacaaagtgacaattgcactccacgtcgctcacgcgttaacgtacctgcactcactggatccgcccattctcc
accgtgacctcaagtcgaagaacattctgctgagtcctgaactggaagcgaaagtcacggatttcggtatctcccgggagcgagaggacagaacgatgac
tgcaggcgttgggacgtccttgtggatggcgccggaagtgatgctgggtcagcggtacgacgacaaggccgatgttttctcgctcggagtggtgctgtcg
gaactcgatcttcacgttttgccttactcccatgcgaaagacagcagtaattcaggtcgaaaactcccggatacagcaattcttcagatggtggcgttgg
ggaagattcacgtcgagttttcgtctgaaagtctgcagtcgatggtggaactggggacttcgtgtgtggcgttagacccgaaggatcgaccgagtgctgc
agaagtactgtataagttgcagttgatcttgcaagaattgtgactccaaggtggctatccatgcaaatagttgagcccaccgatccgctctctctgctcc
gttatagatcatgtaaagacgctaggatgaagttcatcttgcagggctctactgtatgggatactgtagtatctgaagcattcatgatcggatcccgtgc
tcggggatcctttgggaagccgtaaacccacttggaaattcattcgtgtagccaagttgtcggcaaatctaaacaaaaggcgactggcaatgacctttct
atcgtggttcacaaccacgcatgcacgagtcacgtcgcgacgttgctgttgtttgttgaccaattttcggattggattttggtagacgaccaaacgctgt
atcggagctgtagagcatgaaaatttacaacttttgccggtgctgtcgtctacagtactacgatacatgtatgccgcctgtggcacgcaggtgacaagca
cttggcgccgctcgctcgaccgttacagaaagtagtatggccgccaaaagctccatgtctccaccatacttaaacccgtacgttcatgtaatgcacttta
gtgttgcgttagacacgggtgcaacgtacgtctcgtatgccccaagcagcggctggcaaagaaaactggaccatgtgatcacgacaatgtattcccagtt
gaaactttcagtaagtaaattacctagatctgatgcaggcggaagaattgcaaaacattctccaatttccaccccgcaacgtgcgatccaacgcgttttt
gtgaagatttccaccgccacattcgcagcttctcggtcgccgtctggcagttttctccaattcgccactccattttggactccaagccttgcaggaggca
ccgcagcagcgtaggagacagttcgtttttcggtacagtacgcagtctggtcggtcatagactgaaccacgaccttttgcttctattatacaccacactg
ctctctaactttcccccactactctctataaaggtcctcagtcaacttatttccatgttaagctatttctatcattgtatcattttccacagtaatatca
attctcctaagctgaaaagtatgtgagtagcgacctcctacctgatcgtggtggggttgtgtgcagcgtcattgctcgatgcgaccaagttgggccaact
gactccctcatacaataacggccccgccggcagagtgctcgaaggcgcccaaagctcagcaccttcccatccagtaggtaaggcggcaggaggccaccac
cagtgtccaatccgaccatggacgtgggtgcacaggtggaagtgcagttagagccgcagaaatggcgacgcggccaggtcatcgaccgctacgtgagtcc
catcgaggcttccggtgctgtcatcgtcgttaagttcgaggacgggagtgtggccgaaaggggcgtcccagcggatgtgaaccaggacgcacctgacgtc
cgcgtcatcactccagctcaaggccaacagttcgatgtggacgacctcacgcaactcattgaattggacgagacgacaattctttctgctttggagacgc
gattcactcaacacaagatttacaccaacacgggggcgattcttttagctgtgaatccattccagaaaatcgctgatgtttatagcaaagacacgatggc
caagtatttgttgtccttcgagtccagaaacagctccatgcgaagtaaagggaacgaacccatggctccacatatctacaatgtcgctggagaagcttat
aaagctatgatgctcggacttaatggagtcatgagcgatcagagcatcctcgtgagtggagagagcggcagtggcaagacggaaagcaccaagttcctca
tggaatacttagcacaagcaggtgcgaataatctagcggcatccgtagcaggtaaaagtcccgaggggattgcagccaaagtactgcagacaaacattct
gctcgaatccttcggtaacgcgcgcactttacgcaacgataactccagtcgcttcggcaagttcatcaagctgcacttcaccagcggcgggagactcaca
ggcgccagtatccagacgtatctgctcgagaaggttcgacttgtatcacagtccaagggtgagcggaattaccacattttctacgaaatggccatcggtg
cagcccctgcagctcgtaaacgctggttcttggacccacctaaaggccacatgatgcctcctggagacacggaggtcacggaaacaacgcgtcagttcct
gcactaccggtatctgaaccagagcgagtgctatcaacgtcgagacggtgtcaaggactcggacatgttccgacgggtcatggacgccatggatatcgtg
ggtttcacgcctgctgaacgttcaggtattttcgacatcttagcggctctcatgcacattggcaacctgtcgttcgagcatgatgaaaacagcgacaggt
tgggccaatccatgggaccaggagctgggaaatcggacttggcgcctagctgcatctggtctcgtgacgccgctgccacgctgatggccgtcgacgcgac
caagctggaacgcgcactgagtgtgcgtcgtattcgtgctggaacggattttgtgagtatgaagctctccgctgctcaggccaacaacgcacgtgacgca
ctggcgaaagcactgtacggccgcttgttcgactggatggtgaagaagatcaaccactttctcaagatggacgacagccagaaggccaagggcggcttcc
actttattggcattctggacattttcggcttcgaggtgttcccgaagaactcgttcgagcagctgtgcattaacttcgccaacgaaactctgcagcaaca
gttcaacgactacgtattcaaggcggagcagcgcgagtacgaatctcaaggcgtggactggaagtacatcgagttctgcgataaccaggactgcgtgaac
ttgatctcgcagcgtccgactggcatcttgtccctcattgacgaggaatgcgtcatgcctaagggaagcgacacgacgctggcgtcgaagctctaccgcg
cgtgtggcagtcaccctcgctttgaagcttctcgtattcaacgagcacgtggtcttttcactgttgtacactacgcaggccacgtggaatactcgtcgga
tggattcctggagaagaacaaggatgtacttcatcaagaggctgtggatatgctcgtgtactctacacgggaagacagttttactcgcactctgtgtgaa
ggcattggaggctcacgggatcgtgccaaatcatctcctcgtcaacgcgcgcaaacgagcaagcaccgcggcgcaagtgtcggtcttcagtttaaggaac
agcttacgacgttgttagagacgctacagcagacgaacccccactacgtgcgttgtctgaaacccaacgagctctgtaaggccggcatctacgagcgtga
acgtgtgttgaaccaattgcgctgcaacggagtgatggaggctgttcgtgtggcaagagcaggttatccgatccggttaccgcacgatgagtttgtcgcg
cgctacttcagcctaagcaggtccaagaacccgaagaacccgctcctggcaaagaaacaagggaattcgtttggattacctgatacagattcggacgaga
acctagcggttgttagtagcgaggccaaggagctactcaagaacctacttgatgtgattccgaaggagaatgatgccaaccctcagggcgcttgtgaacg
accggatcaaggccagttcaccactaagtgcgtggcagtgggtattcagatgggattcaccaagatgttcatgaagaaaccgacgtacgagtttctggag
gaaatgcgctcgcagcgtctacaccgccacatgatcaagatcttctacgctgtgctgtgtatcactgcccgtgcgcgctatttacgctaccttcatgctg
tcaagacgttgcaaatccgatttcgctacaagaagctccagaagctgcgtcgtcgccgtcagataatgatgatccggaggaaaaatgcaggcaaagtgca
gggcttcattcggactgtggtgcagcgcaagaagttcgtgcagttcattgctgttgtacggatgctgcagtgccgcttccggttccgccggaggatgcga
gcaaagcggatggaagccgaccgtaccaggaaactagcggacttaaagcacaagcagcagatgcaggccgtgacgcagtacacagaaagctcaacggcgt
cttccgagtcttcgtctccacgatcggtgacctcgaactcgaacgacgtcgaaggctccgggtattcagacgtctcatcagattattcctcggacgatgt
gttcacgtacaacgacaacttccccaagcacaacctcaacactgtggacgaacagagcagtcagttgatgccccgtgtatcgcaccgcgtctccctccgc
aagtctcagtccatcgattcgatcactcctatgggcggcttccgcgcctcgcagatgcacaacggcatggcccagacgccgggatctagatcaaggatgc
cgtcgcgcaagtcgtctttccgcaacacccggtcctcgcgtgctgttgcgctcccgagactcgatgtgatccagcacacgtcctgggtgaatgacgagga
tcgtttcagctgccacatctgcaacaagcgcttcaacatgttcaaacgcaaacaccactgccgagcctgcggtgaggtcatctgcaacagctgctcgctg
tatcaccggatccagtcccgatccatgcgtgtttgtgtgtcgtgcgtggcgttccattccctagacagcccaacgtcggccggctctaccggcttcctgc
gtcctggcggtggcagtgctcattcgtccaactccagtcgaaagacgtccaacggatcagcagcagaccgcaaccgcagcagtacgctcagtagcggcat
gtggctgaacccgtggcctgaaccgccctacccggtcgacgaggatgagcgtctgacagtgcttcgagaactcaacatccgagaactcggtctgtctggt
aagttcaacatgtactgcgaagttgcggccaagacgatgaagtgccccatcgcgtacgtgagtattatcgaggacgaggaacagatactggtggccaaca
ttggcatggcgcacacgacgctgccgcgtgaattgtcgttctgcgcacacacgatctgccagcccagtgttttggtggtgctggataccaagaacgacga
gcgcttccgtgagaatccgatggtcaagggcgacaagggcgccgtcaagatccgctactacgccggtgcgaccatcttctctcgtgacggacacgctctt
ggtacggtggccgtgctggacaccaagccgagacgggaggcggaccaggagcacattggcatgttgcaacacctcagcttcctggcgagtgagaagatga
cgcaaagcaccatcaacgaagatagtgatagcgaatttctatgaaccatcaagtaacccagcgatgaaagtgtccgtagctaaagtacaagtagtgcaac
ttcaaccatgttaaaccattttggtatgtcttttctattgaacactcccaagtactatatgttgcaggaacagtaatcgtggagtaattctcattcggcc
acagtaactcagtgcaacatgccaaaagtgcaggcacgaaaggccataacggtgcagtaacttgtcaaaagtgcatacacaagtaatgattggcaatgcc
acatgtattgcgtcgttgtatgccatgtacatgtacggggtggcgtgcgtaggctagaacgaggagcgaatcgtcgcggcaaccttgaatcaggccgttg
tgtccactccagcgacttattgcagcttcagcttcgctgctggccacacacttccaacatggctgcggccatcaactgtccagcgcatctagctcggctt
caatgcaatggccaaaaccgctttctccagatatacagctttgaaacgcaggctttcgatgcgccgtcatagcgacagtcgatcgtgacatccatagaga
gcaggcagaacacagtttgcaaacgttcggcctgtctcgtgcctccgtcttgcaatcgaccagttcggtcaatcattaggcaactgccgattttagtgga
tgacttgacattcttgatctttgttttgaaaagtttacaggcaattgtcagaatccatcgcagaatttactgtgcgattcgctcgcaacgcgcctgttgt
cgtcgccgcgacgatgacgtcgtgtatccgagacggcgtcgacacactccaaatgatctccgagttggagctccaactgacagttggcaactgtgcggta
attatgatctgaaaagttgctctcattctgcaacgtgtcaagtcgttcagtatgctccagttgctcctttgaaactttacctacgttcgcacgttttcga
ccgcgcgcttttcaagttgcgacaaccgcctgtatgtttctgtgagtcactctctatgaatctccaacatactgatgttagttactttgcactcatctga
ctcaaaacactcatactgttcaaacccaattctaaccgatctcaatacaattgtttttgacggtaaaacagtaggtaaacatccctgcaacctaaacatt
ccaggcatttctttccgcattgaacagatgtaccatcccaactctcattctgctatttgcgacggagcactcaagccgcttcctccatactgaaatagcc
actggttgaccgtgttgcgccacattttctctcgttttttccgcagtttgtggtcccctcgccgctctccaccgcccagtaacagtcgcagcatgtctgg
ccagctacgcgtggctgtcatcggctctcagacgtgccacccggacactcccctggcctacaccgtgtaccgaacgtctgtgaactatgaaggtttatgc
taccaccgcctcattcgcttccgccacttctcgcacttcgcgaagaggctcaaagtggcgtctggagctccgcggatctccgtgaagctgcctccaaaga
tctggtggagtcgtaaaacgtcactgcagccggaaacagtggaagctcgtcaagttgtgctaaatgagtacatgcagcaggtttcagcgcgtccacttac
ccctagaagccaggagcggctgcttaagttgctgaaagtgggggagtacgcgcctcaggaggaagaagatcgagtgattaacagtcgaatcagcttcaag
caacaaagcactgcaacagaaccgacgtccgaggttttaggcaagaactcgatccaaacggagatattggaggaagaagatgaagaagatgtatcgattc
acaaggagaaacagtcgcaggactcgttaaccgacgatgaggagtcggaggaacatgctgtgaacttgttagtccaacggcaggactcgaacgcgtccag
taaccctgcagctgacgaggagacgagagatcgcgctctttcagcgcctttgactcctgtgttgcaggtgaccacgaggcctgtgagcagttcgttgaac
tcgcagaacatgaagcgcgtcatgtttggctccggaagcgaagcggatctgctggctctcaaggaaggaggcagggactcgaccggcagcgcatccgact
tttcgtccacccccgagcgtcactacttcggccagatcaagaagtgcatcgctagtattgaggatatcgtggacagcagtcgcaagctcgagacgcgaat
ccgcgagaagcagacggccaaccgacccatttgagttggagcccaatatctttcataaagatgtgcagcggtacggttttgggtggcaaatggatgccgt
tggaattccgctgggaactcgatcatgattccatgtcgcgtcgtcttgctgcaagactgaatggggcttttcaatatttatcggcagtgcagacgttcgt
cgacgtcagcttttcagtgtgagcccctcgaccctgcatctaaactgttataataaaaaatcttaagctaaaataatttgttgggaactcactgtacagt
atccttacagtagagccctgcacgattaacttcatcctagcgtctttacatgatctataacggagcagagagagagggctcagctatttgcatggacact
acactatccacgagcccacggtatctcctctatcctattgatacgtcaacgacgctcttcttcatctctttcttcttcccgcggttcagaagctctttct
cgcgcggtaccagccgcagctcgcgaactgttgtcaagaaggcgaagagcagcgagcccaacgcgtcgtgtgtcagcacccggacgtcgccgtttagtcg
ctgacgttcagtgccgtttgttccgctatctaagcacgaggtgttcacgatcacttggccgtctgcgtgtactaccttagtcaccacgagaaccatcgaa
tggtagtctacgtggaactctgctttgctgtaaattcacagcaccatagtcgttacaaattataccaaaactcaattcacaccaatacacttacacaact
tgcagcaacacttggacactgtgtaactccgcagccgtcatcggtgcaggctgcagt