Description :
From Genome Similarity Track
Location :
Scaffold_492:1211- 6383
Transcript NameFunction/comments
Hyaar_Emoy2814217hypothetical protein
Hyaar_Emoy2814218methyltransferase

Sequence
5172 bases(100 bases per row)
GAAAATTTCAATAACTGCTGCACTAGTCATTGCAGTAAATGACCGAAGAGCAATCGGGTCTTGCAAACAAGTACACCCGCCTCTGCAGTGAGTTCGTCCT
TGTGTTGCATCGTCCGAGTGATGCGGCCCACATCTATGGCAATCCTTCGGATGTTTGGAGTCCTTGTCCCTACCGACCCAGAGCAATTAACGATAACTTG
ATTCAATACATAATGGTTGGTAATTGCTAGTGTACATCTCGTATTACGTTATGTACCCGTGTGGATCGCTTTGTCGATATAAAAGCTCCTTTACGACAAC
CTGGCTAAATACATAGTACAGAGCCTCCCTCGCTAACCTTGTCCCTGATGACTAATATTTTCATTAACTCATAGGACAGGACAACTACTTGGCTGTTCTG
TGGTCGTTCTGTAGTCGCTAATTTATACCTTGTAACTAATAGCCTAGAAGCTAAATATAGGTGTACAGATGGAGAATTTTATTAAATGTGCGGGATAGAA
ACCCATTCAGACTAAGCATCAAGGGTGGGTTGTGTTGTGATGGCACTGCGAATGTCAGCCTGTAGGCTGCGGAGTAGCTTGTAGGCAGGACGGTGAATAT
CCAGGGACAGTGAATGCAAGGTACAGGCACTACCTAAGATGGTGATCTCCCCGATGGTTGAAAAAGAAACAGTTTAGTCTTCTGGTACGGAAACCTATAT
GCGACCAGACGTTCAGTTGGAGCTTGTCGGTCTAGGACCAAGAAGAAATCAGAATACCTAGAATCGAATTTGAGACTAGGCTTGATAGCGGTAAGACTGA
TAAATTCTCATATACATGTCAGTGTTGTATTTGCACCGAACTGGGAAAGAATTTCTTGTTTCTATCATCAGACTTGGTGATCTGTCCGTAACTGCTTAAT
TGGTTGCTTACACTATATCTTGATCATTGATCTGTGGATGAACATCCTCATCTTCTTCGATAAATTTAAAAGTTCATCAATGAAGAGCCGAAAATGGCAC
TTTGTCCCTCACAATAAACATCTACCCCAACAAACAACCAAGATGGCTACGTGTTTCTGACCTTGAGGAACAACCTGATCCAGATCTAGAAACGACAGGT
GAGGACCTGTGTTGGTGGCCTCTGGGGCTCTTTTTCTGCTGGATTCCAATTAGATTATAATTTGGGGGTGGAAGTGGAGTGAGTGGTTCTGGTGGGGGTG
ATTTTTGATTTTATTTATCTACAGTACCATAACCCGATAACTAATAACCTGTAATATCTTTTAGGAAGGAGTGTTTACTAAGACTAAAATGTTAGCAGAG
AGAGGACTGTAAATGTTATTGATAGTTATTTTCTGGGTAGGAATATATTCACCCCCCCCTATTTTTAACTATTTCCGCCCCAGAAACTAAAACAAGTTTT
ACTTTCTTTTTTAAAAGAACAGAGCGCGGTGCACAAATTCACTTGCCGCGAAAACAGCAATGTACGTATTGTCCAGAAAATAAATATACTCTCAATTAGA
GCTGACCATTTTGAGATCAATGCTCCTTTAATGAGGAAGATGATGACGAGCACGTCACTTATCTCCAGGGAAGGATGCTTGTAACGGGGCACACCTTCTT
CAAGAAATTGAATAAACCTTGCACTGCTGACAGTGCAAGGACGTGTGCTTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGAGT
AAGCGTATTCAGTAAAGGTAAAAAGTAGAACTGAATTTAGTATAGTTAATCCTTGTTATAAATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAA
CATGTATTATAACTATCTGCGCGCCCCTCGTTGCGGGCTTTTGTCGTGGTTAGGGTTTATTGGTTGATATCTTGATCCTATATCAACCAATGAGCAGTGT
GTTACATCTGCGGGACAATAATATCGATTAGGATAATATTGTGAGAATATTGTGTTTGTCCTAACGCAATATTCGTATTTGATATTTACCTTAAGTAAAT
TATCATGTAACGGAGGCACCCCGTTACATTACCCCCCCCTTTAACCATCAGTCACATTAGTGACTGATTGACTATTGAATGACTCTTTTGAGTGGCTCTG
GGACAGGGAAGCACTGGCGGCCAATCCATCCATTCTTCATTCTCATCGCATGGTTAACAAGTCCATGCAGTGTGCAGCCAAAGCTGCTGAGAACGCGGCC
ATGAGACTCCGCTCTGCTGCCGCAGGGGAGACAGGATCACCTGAAGCAGCTGACGTAAGTTCGTCTGGTGCTTCCGCGACTCAGCCTGCAGCAGTCGCTA
CTGCAGGCGCACGCGGTGATGCACCGCGTGACATCGGAGATTATGAGCTTGAGCTCATAAAATCTAGCGAGTCTAATGGTGAGACCGACTCGAAGGAGGC
AAAGCCAAGGATGAACAAGAGTTGGCTAAACCGGAGCCGACTAAGTCGGCTTCTCGAAGCGCTTTAAGCCTTGCAGATCGTCGTGACATCTTCGGATCGT
CCGACGAGTCAGACCCTCCGTATTCGAGACGGAGTCGTTCGGCTGAGAGCGAGAAAGGCCATGGCTTTGGCCACCGGGACGATCCTGAAGGTGATGCAAT
CATGCTTCAGAGTCCGGGTGATCGGGATGATCATGGTGTAGGTACTTCTATTGACACCAGACAAGAGACTGTGGATCGCAACATCTTGCGTGTTGCTCCC
GAGAAGAAGCCGTGGCTACCTCCTCATAGAGTGTTGGCTCGTCTGTCCGACACGACGAGTGATCGTTATCAAATAAGATTATTCGATTCATCAAAGCTTC
ATAAGCTTGATCCTAGTGCGAGTAAATTTCGCACTGAACATGATTTCTTCATCGATGCATTCTTTAAGCATCGATGGTACAGAGGGAATCACAAGCGTGA
TGGTCCCTCATTGATTCAGGCATGGAACGCTTTCATCCACAACGTTGGTGAGATTGGGCGTGATGCCTGGCTAGACAAGCTATTGCTAGCTCGAAAACGG
TTTCAGAAACGGCCCTCTACCGGTGCACGTTTTAAACTGCATCGGTTGTCAAGAGAGGCCGGGCTACCATGCCTCTATTAGGGTGATGCGTGCCAAAGTT
GTGTGAATAACTTGGCACGAGCTCCAAAGGAAGCTTACTCAATGGCTGACCCCTGGTGGAGGGTACGTGTCACACAAGAGATGGACAAGGGAATGGCTAA
TTTGCAATCCCTCTACTAGCGCGCTGGGCGTTCGTTCCCCGATGGGCCTTCTACGGCATCAGATGCGCCTTGTCATACTGCTTGACAAGGCCCAGAACAT
CAACCAGCAGTTGAGAGCGAGGCTCCCAACTATCTGCCGAGGGTGGATACCCGCACCACTGGACGAGGTAACTCGTCTGACGTCCCTTCTCATCGCGGTG
GTTCAACAAGAGCTCCACGAGAAAGCGTTGGCCACCGCGCGCATCAATCAATGGATGAGGCGGAGGAGGAAACACGTTCTCAGACGGGTTTGCAGGCTCA
ATATGATACTGTGAGCCAGCTCGAGCGTGTAACGTGTGAGTTGCGCGAGGATCTCGAGCACGAGAGGAGCAGACGTTTGGGTCTGGTCGACAATGTGACG
CGTCTCTCCTCGGAACGGGAGAGAGATCGATCTGATTTTGCGCTTGCTCAGCTTGAGAACGAGCGGACTCAGCGTTCTCTTCGCGACGAGCTAGTGGAAG
CTCTTCCGGATATCTCTCGGCTTCGCAAGGAGATATCCAAGCTTCAGACTCGGGCTGATAGCCAGCACCGCGAGCACAAGTATCTCTTGGAGATGCTTGA
GCAAGTGATTTCTTCACCAACAGAAGTCCCGTACTGGTGATAAGATCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACATGGCAGTTCA
ATCGTGTATGCGTTGCCTAGCGGCGCAGTACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCATGTTAGTCACTATGTGTCGAGGTAA
GTTTACCGTAGATAGTAGGACTAGGTTACCTTCATTGAATGAAAGAACATTTGCCGTTCCATTCTTGTCTACGTTTTTCTTTTGTCGGTCCACTGCTTCA
GCAATGGAATCTTGCACGAAACGGACAACCGTTTCGCGAGCCAGTATAAATTCATTCGCTGACTCGCTGTCTTTAGCTGTAGTGCGCTTGGAGCTCACTG
TGGCAAGATCAGTGACCTGGGTAGTAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGTGTCATACGTAGTGAC
TTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCATTCGCTCGAATGATTCCCTCTGCCCTCAAACTAGACTTATACTCTAAGAACGTGAATAGGC
GTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCAAATTCCACCATTGGCGAGAATTCGCTCCA
ATTCTTAAACAAATGGACATAACCCCTAAGGATTTCCTCAAGAATGCGGTTTGCACGTTCTGTCTGACCGTCTGTTTCAGGATGGTCAGAGGTCGACATC
TGAAGGCACGTTCCGGGTGTTTTGAACACGGATCGCTAGAATTCTGCAGTAAATCGTGGGTCTCGATCACGTTCAAGAATACCTGTATTCTTATGTGGGT
CTGCGGGGAATCCAACGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATAGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACCAGACTT
CACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGCACGAGTTGATACTGGCGGGGCCAGTAAAAGTCACGACTAACTGTGAGATATGTCTTCTCT
CGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTCATACATGATGTGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGGCGTGTCGCCGG
CAACGGCTGTAGACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATTGATATACTGGGGGCAACCTTTTAAGGGATTGACGGGATGTTTG
CGAGACATGTTTCATCAAACGCACCATCGCCGGATAGTACGCCATGCGTATGTCTTCTAGTAAGGTTGACGA