Description :
From Genome Similarity Track
Location :
Scaffold_1700:1211- 3964
Sequence
2753 bases(100 bases per row)
TGTGACGGGTTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACTGGTCCCCTCTTTAATTAA
AGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGTGGTTAATACAAACTATCAGTTACCTATAGAAAT
GCAATGTCATTTAACCAATGGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCA
CACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACCAATCAGAATGAAGAGATGTTCGT
CACAAACTCTCATTCTCAAAGTCGAAAACCATCGACTCGGCCGCGCGAGCGCGGCGGAGGCTCACTTTACAGTTAGAGCCTCGAGCAGCAACCTGTGCGC
TCTTCGTCAAGGTCTCCACTTCGACCGTTAACATGCCTCGTGGCACTGCTAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCAGCCGGTAAAGGCGCAGG
GCCAAGAGCACTAAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGATCCTCGGGTGACGCGGCTGCGGACA
AGCGCGCAAGCAGGCGCCGCAGTCCGTCGCCCTCGTCTTCAGACAATCGTCCGAACCCTCGGTTCGTAGAACGTGAGTTCAACTCGGGCAGTGAGGACGA
TGCCGAGTTCGAGAGCACTCATGATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGAAGACAGCGTGCAGTCGTCCGCT
AGTGATCACGGTGATCACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGCTAAGGGCACTCCCAAAGCCGGTGGCGATGAGGAAGGGA
GTCCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACTGCCTCTCAGTC
TCCACTCCGCGAGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGACTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGT
GCCATTGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCG
TCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCT
TGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTC
GCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGGATTTTGGGGGAAAACC
CCCGGGGTTTTGGCCCCCAAAATGGTCCCCCCCGGGAATTTCTGTGTGAGAAAAATGTTCTGGGCCTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGT
TATGGGAACTCCATGAAGATCAGCAGCTGTTCTACATTCTGGAACAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCCAG
GGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACT
TATGAAGCTGCTCGCCGCTTCTGTTCCTCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTCAATCCGGCTCCCACGAGTTCTCGGAGTGGGCA
TAACCCCTCCACTTCACGAGGAGCTGTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTTCCACGTGGAAGTGGACTCTCCATTCCGGTCAAGCA
GGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTCCCGAGAGACACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGG
TTGACCGCCTCCGTCAACGTCTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGC
TCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTT
CGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGT
ACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCC
GACGCCCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAA
GACGTCCGACATAGACACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGAT