Description :
From Genome Similarity Track
Location :
Scaffold_501:1211- 3484
Transcript NameFunction/comments
Phyag_g6210conserved hypothetical protein
Phyag_g6211hypothetical protein PHYSODRAFT_484729

Sequence
2273 bases(100 bases per row)
CAACAACATGAACTCCCGCGagtggatggagacgccCAGCGTCAGtttggacgagaagcgtcTGTTGCACAACATCGATCGGATGCAggcgttggcgacg
gcgaaCAACGTGAACCTCCGTCCTCACGCCAAGACGCACAAGACGCGGGAGATCGCATCGATGCAATTgggagctggagcttgtggtCTCACCGTTTCAA
AACCTTCtgaagcgctgcagttcctgcGTGGTGAAGTCCCGGGTCTCAAGAGTTTGACGCTGGCGTATCCAGTCGTGCAGAGCAACAAGGTGCAAGAGGT
GGTGAAAGCGGCACAAGAGGTTGGCATCGAGTTCCAGCTGACGGTGGACAGCTCAGAgggcgtcgacgctgcgcaGAAGGCGGCGGAAGTTTGTGGTTGC
ACTTTGAAGTTGCTGATCCATGTTGATGTGGGATATCATCGCGTGGGCATTGAGGAGGACGATCCGAGACTGCTGCAATTAGCGCAGAGGATCGAGAAGA
CCAGTAATCTGGAGTTCCGTGGCCTGCTCTCGCACGCAGGTCACGCTTATCGCTGCAAGTCGGTAGCGGAATGCTCTGAAGTGGCGGAGACGGAGAGGCT
GATTATGGTTCGCAtcaaggagatgctggagaaaaaTGGGattgctgttgctactgTTTCTGTGGGCAGTACATTGACGGAACCTGCTCGTAAGAGCTTC
GAGGGGATCACGGAGATCCGTCCTGGGAACTACGTGTTCCTTGATCGCACGCCTGTGCGTATGGGACTCTTTTCGGTGCAAGATGTCGCGCTGACGGTCC
TTGCGACGATCGTGAGCTCGAACAagtacaacttcatcgtTGACGCAGGATCGAAAGTGCTTAGTTCGGATGGAGCTCGATCCGCTGGGGAGTTCGGCTC
AACGTGCTATGGTCTCGCATTTTACGAAAAGGATTTCGAGCGAGTAGTAAACGAGCCGACGCAGAACAGGACAACGCTTGACGATGGCCATGAGCTGATC
TGCTTCGAGGTGACCAGCCTGTCAGAGGAACATGGCTGGGTGAAGAAGGTTGAAGGCATTCCTTCGCCTACTATCGGCGAACGCCTCGTCATCGTGCCGA
ACCACGCCTGTGTGGTGTCCAACCTCACCAACAAGTTTTACGTCCAGGGcgagaagccgaagagctGGACCCTGTTGTCTCGTGGATGTACGCAGTAATT
TACCCGTGAGCTTACTGGTTGGGTTTCATCTGAACATCGCAAAATTTGTATCTCGATTAAAACcattggagctggaggtttTGAACAAACTCTCGGTTAG
CTTCGTCGCCCATGCGGTGTAtcagctcctccttcgttTGCGGCAATTTACTACCCATGCCGCCGTCTTTAGCTCGGAAGTTCCCGAGCATCTTGATAGT
AGCAGCCTCAATcacttgcagctctcgcttGTGCGTCGTCATGTAATGATCAAAAGCTTCCGTTTGCAGATGAGATTcatgcagcgactgcacccATTCC
TTCTCGTAAATCAATTTCAGTAAATGTCTGCGAAACGGAGATCGCAGTACTTTGTTAACCATGGACCTGAACGCCGCGGTATCCACGTCTGCTGTGTTTT
TCGAGGCATCCACAATACTCCGATAAAACGCAGCACTTTCAGCTTTCGAGGTAAGTTGCGGTGAATGATACATCCATGTCGTGAGCGCATATCTCGGTTT
GCTGGAAGGCATCACGCGGTGCAGCATTTGTTGCGATGAAAAGAGAACCAATTCACCGAAGCGCGGTTGCACCACGACACGCGACTTCGGGAACGGGTAG
AGTACAATTTCGCCTCCGTCGCCTTGCTTCCATTCTTCATTCAGATAAAGGACCGCTGTGACGCACTTGCCGTCGTCACCGTACGTGTCGAAATGCATCG
GGAAGCAAGCTCCTCGCCCTGCATTGTGCTGCACCTTGACCATGTGACCTGCCAATCCCAACCAATttggcagcaattgctgcaatggaCCAAAgaccac
ttgctgctcaaaGAAATCCCGGAGGAAGGGAACAGACGTCTGATCACGGATCGCATCCAACGCCAACTCAGTTTCGAGAATGTCGTGTTTTTCCAATAGC
AACGTCTTGGCCGTCGATGGTGCATTGCTTCCATCTGTGTCGTTGAGCAAAATGTGCGTCGAGTTTGGATACAATTGGCCACTCGTGTGCAGTAACTTCA
TTTCGTCGCGAAGGTGGCGGAGATACTCGCCTGGGAAGGCGTCGTGCACCACATAGTAGCCATCACGCAGGAG