Description :
From Genome Similarity Track
Location :
scaffold_9:121097- 123341
Transcript NameFunction/comments
g4504.t1 DNA replication licensing factor MCM5

Sequence
2244 bases(100 bases per row)
TAGACTCGAGTGCAGGACTACTTGACGCGGGATACAAACTTGTACTGGCTCAGCTGTCGGAGGGAGCCCTTCTGCACCATAGCTCGAATCGCGCGTTGAA
TAGCGTTGGGGTTGTAGCCCTGCGCCTCGAGGCGGCTGTACAGTGCACTGGTCTCGACGCGGGTACCAATACGCAGCGTGCGATTGATACTCTGCTCCAC
CTCCTGCGCTTTTTCGTGGAAGCCGCCAAACAGTCCCTGGGTGCCGTCGTCCTTGGCAGCGTTCATCGTACTCACGCTGAACAATCGGATCGCCTCCTGA
ACGTGGTCGCGCGTGGCCTCGTTAAGCAAGTGCATCTTCGCCAGCGATTCCGAAATACGCACGAGGGCTTCGAGCTGTCGGACAGTGACAGGAATCGTGG
TCTCACCGCCCTGTGTACGACGCACGTCGTCACGCACACCAACGTAAAAGTCCTGAAGCGCCTGCGCAGCTCCAACCGACAGCCTCGGTGCGCAGCGAGT
ACGGCAGTACGTGATAAATTTCTTGAGCAGCCACGGCTCGAATTCACCGCCGCTGGAGGAGTTTTCGCTGGCCAAAGATTTGCCAGCAGCCGACGCCAAA
GCGTTTGTGTGCATCCGCACGACGTGTGCAGCCATTTGTCTGTCTCGAGCGTCATCCTGGATATCACGCACGATGAAGATCATGTCGAAACGACTCAGAA
TCGTACTCATGAGGTCAATATTCTCCGAAGCCGAGCGCATGTCGTCGTAGCGACCGAACACGGGGTTGGCAGCGGCCAGCACACTGGCGCGTGAGTTGAG
AATCGTGGTGATACCAGCCTTGGCAATGGAAATGGTCTGCTGCTCCATGGCTTCGTGAATAGCGACACGGTCCGACTCGCGCATCTTGTCAAACTCGTCA
ATGCACACCACTCCACCGTCAGCCAGCACCATGGCGCCTCCTTCCAGATAGAACTCGCCCTTGGAGTCGCGAATCACAGACGCCGTCAGACCTGCTGCAC
TGCTACCTTTACCCGACGTGTACACGCCAACGGGGGCGATTTTCTCCGTAAACTTGAGGAACTGCGACTTGGCCGTACTTGGGTCTCCCAGCAGCAGTAC
GTTAATGTCACCTCGCAAGATCATCCCGTCCGGCAATCGCTTCCTCGATCCTCCAACCAACAAACACGCAATGGCCTTCTTCATATTCACCGTATAGTCA
CCATAAATCGACGGCGCAATGCTGGCCGCCAATTTCGGGTACAGGTTCGGATCTCGTGCCATCTCGTGGAATTTCTCCTCTTCCGCAGGGGAGAACGTGG
CTTTCGCGCGTCCAGCGCCTTCCTCGTCGATCTCAATGCCTACCACCCGCAAATACAGCGTGCGAATAGCCACAGCGCCGACGTTTTTGCCCCCCGCATT
CACGACGGATGTAATGCCCACGACTGACACTCGCGTCCCGGGGGACGCTCTGTCCACCAAGTGGCGGTCCGCAATCAGCGCCAGATTCCGAGGCATTTCG
CCCGTGGGCACCACCTCCGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCCACGTACTCGCCCCTGTCGGGCAGTACAATGTACGAGTCCTTAGGACAAG
CGTCTCCCGGAGCTACGCCATTGTCCTCCTCCCGCATGCGGTCACAAATGCGGGGGATGCTCACGCCGCCCATCCCCGAGACTGCAACACGCTTGACGTG
TCCGCAATTGCGGCAACGTAACGTCGCGGACACGCACTTGGTCCTGACACGAGTGGCACTGATGACGATGCCAGGCACTGTTCACCAGTCGATTAATCTC
CTGCGCGTGCACGTGACGAAGTGCGACAGGCGCCTGGTCACTAGTCAGAATGGCCTGGATGTCCGGCAAGTTGGCGGAATGGTTCTCAGATGCGGTCGAA
GTAGCTTCTTGGTTGCCGTTGCCGGTGACGAGCAGCTGTGCCAACATTTCCTTGGCCGCGTTCTCCAGCAGAGGTAGCTGCTCCTTCGGGCTCTTGAGCA
AAAGGTCTTGCAGCTCCTGGTCGAAAGCCGCTACGTGTGACACGTTCACCGTCACGAACCAGTGTTTGCGCCGCGCGTTGGCCAGAAGTTGCTCGCGGTA
GTAAAACAGCGGGCCCACACGGAACCCGCGCAGGAAGGCCAGCAGGCGGCGCTGCAACGCGGCAGGGCTCGCGCCCTGACGATCGTCTGACGCCTGCGCG
CTCTCCATGCCCACGGCCGACACGCGACCCGCATCCCAGTCCAT