Description :
From Genome Similarity Track
Location :
Scaffold_4:12103- 15154
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4-fgenesh-gene-0.4CENP-B homolog protein 2
Pytiw_DAOMBR242034maker-piw_contig_4-snap-gene-0.47Conserved gene of unknown function

Sequence
3051 bases(100 bases per row)
CGCCGTATGCGACTGACGCTCGGACAGAAGCGCGAGGTTGTGGACTTGGCCGCCAGCAAGAAGTTTACGCACCGCGAGCTCGCGGAGAAGTTCAGCGTCG
GCCGCACGACGATCACCAACATCTGCCGCCAGGAAGAGCTCATCCGCACCGAGACGGACTCGGCCGACGCCGCCAAGAAGAAGCGCAAGACCACCAAGTG
CACGTACGACCTGCGCGTGCTGGACGAGTGTCTGCACAAGTGGCGCATGGAGGCCAAGGTGAGCACGCCCGACATGAAGATCACTGGCACCGTTCTCCAG
CAGAAAGCCATTGAGCTCGCGCTCAAGATCCTGCAAGAGCCGTTCGCGGACCTGTCGGACAAGGTGCGCCAGGCGCTGACCAAGTTCACGGCCTCGAACG
GCTGGCTCGATGGGTACCGCACGCGCTTTGGATCGTTCAGTTCGAAAGTGCTCCAAGGTGACCAGAGCGTGATCAAGAACGTCGAAATCCAGACGCGGCT
GCGCGAGCTGCACCACAGTTTACAGCAAGTCGAGCTCCAGGATATCTGGACGGGCAGCGAGTTTGCCGTCTCGTACAAGCCGAGTGTCCTCAGTCAGAAC
CCGAACGCGCCGTCGTCCGGTGCGAACGGCTTGTCTGGCGACGGGCGGTACATCGTATCGCTCTTTGTGAGTGCGGCTGGCGAGAAGTTTGACATGCAGG
TGGTCGGCACGGACCGCAACCCGCAGCTGCTCGAAGGCATCAACGCGCAGCAGACGTACAACATCCAGTACGGCCACTCAAAGACGGGGCTGCAGGTGGC
GCACACGATGGTGACGATGTTCAAGTCGCTCAACGTGCTTGCCAAGACGCGCAAACGCACGTTCCGCGTGGTGCTCGACAGCGCCGTGCCGCACGTCAAG
GCCGCGATGATCCTGGACTCACAGGGCGACCAGCGCACGTTCTTCCTCTACGACCACCTGCAGATCTACTTTCTGCCGCCCAACTTCAAACCGCCGCGGT
TCCATCCGTGCCACTTGGGCATCATCCAGGCTTTCAAGGCGCGCTTCCGGTACGAGATGATCGAGACGCTCTTTGCCAACTACCGCCGGAGTGTGATAAA
CCAGGACCTCCACGGCTTCCACCCGGTGCGCCACATGCACACACGCAACGTCTTCCACTGGTTCTACGTCGCGCTCCACAGTCTCGACAAGCACATGATT
CAGAACTGCTGGGTGCACAGCGGCCTGCTGCCCACGCAGGCGATCGCGACGCTCAACATGAAGGAGATTTTGTCGTCGACCTCGGGCAGCAACGGCGGCT
TGTCCCTCCCACCAACCAACACGACGGGGCTTCCGAATCTGGCGTCCATCTACCACGACCTGCAGGTGCTGATGAACGAGGTGACGCAGATGACGCCCGA
CTTCCTGCACTGGATCGGCGTGGTGGACCCACTGAACGCGCAGGCATACGCCGAGATGGAGGGCAACGCGCCCGTGACGGATCCGGGCGTCGACGAGGTC
CAAATCATCCGTAGTGTGCTGCAGAAGCACGACTGCCTGTCCACGAAGAAGCTTGACGACGCGACCCGTGCTGCGGGTCACTTTGAATCGCTCGATGACG
TCGCGGAGGAGCAGTGCCCGCGCCCCGATGAAGTGTTGGGGGCGATTGAGACTCTGAAGAAGTACTTGCGCCTGTCGAGAGACACGATCCCGAACCGCGT
CGACGCCGTCGTGCAGCTCAACAAAGTCAAGAGCACGGTCGGGAACAATGTCGTCCACGACGTCTGAGTGTCAGCACACGGCGGACAAAAAGCTGGTTCA
AAGTGTTTGTATGTCTATTGCACCTGCTCAATATCTATATGAAGCGTATCAGCTGGTTAACCTTGCTGTGTTGTTATTTGATGAATGAGAATCGCAACTC
ACATTGGCATGGCTTTGGGGAAACTCGAAGGCGGCGACGCGATCCCCATCAAGATGTCGTTGCTTGAGTGTCCTGATAGCTGCAGATCTTCAAGCGGCAA
GATGCGTCGCTCGGCAATGGCTCGTTCTTCAGCTTCGCGCTGTGATTTTGAGTACGAGATCAAAGTTTGCAGTGCACTCATCAGCCAATCTCGATGGCTC
ATACTCTGCGTCTCCAAATCAAGCGTCCGATCGCTGAAGATGATGGAGAACGAGCGAGCTTCGAGCGCGGCACTAGTCGCATACTTGCGGAAGACTGCTG
TTTGCCGACCGTCGAACACCTGCAGCGCCTGCGCTAGGTCCACAGAGTCACTCAAGCTGCCTCGCTTGTGCTGCCACTGCAGTGTGCCGCAGTGGTTGCA
GTGCAGCCTCGTCGGATGCGACCCACCTCGACGCCCGTACTTAGTCAGCGGGAAGAACATGTTGATCGCTTGCACGAGGTAGAAGCGGTGCTTGCCGCCA
AACCGAAATGCCAACTCCACAATCTTCCACCTCGCGCCCTCGATCGACTCCAGCTCTTCATCAGTGTAATGGAACGTCTTCTTTTTCCGCCGGAAGTTCA
GCGTCTCAAGCAGGCGAGGGGCTAGTCGTCCGAAAGTCGATTTCTTGCGCTTCCGTTGAGCATCTGGATTCCGTGCTAAAGCAATCGGCGTCGTTGATGT
GGACGCAGGAAAGACCGTCGGTGCTGGTGGAGGTCGAATTGGCACCGGACACGAGTTTCCGCGTCTGCGCGCCGCGAACCCATGCTGCTGATGCATTTCA
TAGCCTCGCTCAGCATCGTCTTTGAGGTCGATCACGAGTCGGCGGACACTGACTGTGAGATGCAGCGGCATTTGGGCTTCAGGGAAGCAGCTTGGCACGT
ATGTCGGGATCACAGTGGTCTCGAGCATGGTCGGCTCGAGATTCTCGAAGGTGGTTTCACAGCTATTGTCGTCGTCGTCGTGGTCCTGAGCGTCGTCATC
CTCGTTGGAGTCATCATCGCCATCTTGATTTGACTTGATCGTCAAATCTGCATCCTCGACTGGGCCACTCATGCTCTGGATCCTGTGCATCAGCTTCCTC
ACGCTCATGGTGATGTTCGGCGCGTCGAAATCCAGCTCTTCGTCGTCGTCG