Description :
From Genome Similarity Track
Location :
Scaffold_3:1210255- 1214666
Transcript NameFunction/comments
Phyin_T30-4PITG_02254Putative uncharacterized protein
Phyin_T30-4PITG_02255Histone H1%2C putative
Phyin_T30-4PITG_02256Aspartate aminotransferase

Sequence
4411 bases(100 bases per row)
AAAGCGATGTGAAGAGTTAGTGGCCGAGGTTCAGAAAGCTAAAGCCGATAACGCACGCGAAGTTGAGCGCTTTAAGCTGAAGCTGAAGGATGCCAAGGAG
CGGTGGACAGTGCAGGAAAAAGTTCGCCGAGACCAGTGGATCGTCAAGAAGACGGAGGAGATCAAGAAATCGACCGTCACCGCGTTGGAGCCTGACATCC
AGATCATTCTCGCTAAAGGCAAGACAGATCTGGAGAAAGCACGCGAGGCTGCCCGTGAAGAACGTCGAAAACTGCAGATACAGTTAGAAAAAGAGCGTGA
TGTCGCGTTGCAGCGCTTGAAAGACGACTATGAACGAAAATTGGTCGAGGCAAGAGAGAAGGAACGTGGTAAATTCATGACGCGCTTAGATGCCGCTGAC
GCGGAGTTGCAGCAACAGCTCAGTACGCAACGTCGACGACTACAGGAAGAGGGCGAGGCAACAAGAAATGAATTATATGCCGAAATGCGCGCAGCCAAGT
TGGCACATGCCAAAGAATTGGACGAACTTAAAGCGTTGCATATGCAGAAACTACAGACTGCAGCCGAGAAGATGCAGAAGGAGAAACAAGAGATTATGGC
CAAGTATGAGAGCGAGTTTATGGCTCTACGGGGACAAATGAGTGTCGAATGTGAGCAGTTCAAGGCGCAACTTACCATTAAACTACGCGATGAAATGAGT
AAAGAAAAACAGGAATTGGAGAAGCAAATGTTGCAGTCTCGTGATGCAAAGATCGAGTTGGTGATTGAGAAACTCCAGGAAGAAAGCAGACAGATGGTCG
AGCGTGCTGAGCGGAAGGCACAGAAGAAGTTCAGCCACGATCGAGCCGAGTACGAGCGTAAACTCAAACAAACAGGCGAGATCGAGGGCGTGTGGATGGA
AAAGAACCGCGAACTGCATGAAAAATTGAGCAAGCTGGAGCGACAACACGACGAGTTGAGGCGCGAGAACGAAGCGCTTGGACAGGACTTGCACCAGGCA
AGCGACAAAACGAGCGACTTGGCACGTCGTCTGCACGAAGAGCGAAGGCAACACGAAGCCTCCGTGGCGCAACTGGAGAAGCGCTGCATCTCTTTACAGA
CCGACAGCGAGTACACTCAACAGCAACAGAGCGTTGAGGTCACGTCCCTCCGTGAGAAACAGGCAAGTATGGAAAGTCATTTCCAACAGCAAGTCCAAAA
GTTGCGTGATGAACACGACACGGCGTTGGCAAATTTGCATGAACGTGTAAAGGCAACTGTTGCACGAAAAGATCAGGCTATTGCTGAGTTTCAGGAGGAA
CTCCATTTGTTGCAAGTCAAGCTGGACAAAAGTCACGCTCTCATCGAAGAGCAACGTTTGCAACTTTTCAGTTAGTAAAATACAAAAACATTTTTTTTCA
AAGCAGTTGGATTCCATTTGGAAAAATAAGAATAAAGGCTTCGGAGACACGACACCGCGTCGCTCCAGCGAATACGAACTAGTAAAAGAACATAGTGGCA
GGCGATAATGTAGCTTACTTCTTGGCAGTCTTCTTAGCCGCCGACTTCTTCACCACTTTCTTCTTGGTAGTCTTGGGCTTTTTAGCCGTCACCTTCTTTG
TAGACTTGGTGACCTTCTTAGCAGTAGGCTTCTTGGCTGTTTTCGTCGTCTTCTTTGTAGACGTCTTCTTCGCAGCGGGCTTCTTAGCCGTCTTGGTAGA
CTTCTTAGCGTCAGACTTCTTGGCCGACTTAGCGGCAGGCTTCTTTGCAGAGGTCGCCTTCTTAGCAACAGGCTTGGCAGCAGGCTTCTTGGCGGCGCCC
TTCTTCTCCTCAGCAGCCAGCTTAAACGAGCCCTTCACGGGCACCAGCTTGCCGGACTCGACTCCACGCTTCAGCGCGATGTTAAGGCGAGACTTGGAGT
AACTGGCGCCCTTCTTTGCGGCGACGTACTTGTCGATGGCGTGGCGAGACGAGCCCGAGCGCTCCTTGAGAGTGAACACAGCCTCCTTGATGAGGTCGTA
GTAGCCGGGGCCGGCGTTGGCCTTCTTCGTGGACGGAGCGGACGGCATCTTGGTGTATGGGTGGAGCTTGGGACTTTGGTCTTGAGACTTGAGCTGGAGT
TGGAAAATTCCGTTGTAAGCGATGTCAAAAACTAAAAAAATCTCGTTTTTCACGGAGTCGTCACATGTCTTTCGACAGGCCCGTTGAAGTGGAGCTTTTA
CTTGATTTTTGTAAGCATTTCGAGCGCGCGCGTAAATTTAAAATAAAAATCCGCCAATCAGCGTGCGAAGATCGAAGACATCAAGAAAAAAAGCACCTGT
ACAAAAAAAGCTCCGGCTTCCTCGCAAAAGCGCGGCGACAGGAACGCCAGTGAAAACACTGGATGTATAGAGACGGGATGGAGGATGGCCAAAGGGAGGG
GGGTCACGTAGGAATCGCCCAAGTTAGTCTGTGGACTGCCACGCGGCGTGGGAGTGCTCGGCCTCTAGAGAGCGCCAGCGCACCGCGCACATATGTGCGG
CTTGCTCATGACGTGCCCAACGTTGGGGTTATGCTCGTTTCGGCGTGGGGTCCGCCGTTGCCATGTCCGAAATTAATGTCACGAAAAGATTTTAGGATTG
TCATTAAGGCCGGTTTGGACCTTAAATGTCACCTGTCCCATAATGACCCATTGAGTTTCCAGGCGGAACACCAACGGGCCAGGCGCTCTACCGGGTGCTA
GAATGATCGGTGGCTATTTAAAATACGCTGAGTAGTGCTCAAGACAGGGGCGATTCTCTCTTTGCAATTCTTATTGGCCAGATCGACCTACAGCGCACGA
TATCGCTCGCTTAATGAACCTCTACTTCCATTTCCATTTTCGTCGCGCGGGGCCAACCGCGGACACCTTGGTTGGGGCCAAGAAAAGGCCGGTAAAAATA
CACCGTTTGTCTATTTAGCCCTTCAATACATTAATATACTTCGTAATAGAGCTGTCAGCTCGATCCGAGCTCCGGTATCATGCTTCAACCGTGTACACAG
GCGTCGAATTTACAGCGAGGAAACCTCTCCAGCCTTCCTAAACAATGCTAATCTCAGTCGGCAGAAAAAAACGGGCAACAACCAAACGGTTTGTAAAATA
TCAACATACTATTTTACAAAGCTCCAGCTGAAGCCTTTATATGATCTGCTCTAAGTGTTGATGCTGCCAGCCAATGCATACCTTGTCGTTAAGGAGGTTG
GCCACCGGCATGACTTCGCTTGCGCATTTCATCACTCCCACAAGAAAGCTCGCAATCCTGCATAAAAGTGGGCTCAGTTTAAAACAGCATGTCTAGTTTC
TTGCGAGAGGGATTATTACATTTAAGAGGGTGTTGATGAGGTAGCTCCGATGCCAGAGACTCGCAACGCTATTCCTATCCTTGGGACAAATTCGTATTCC
CTCCGATTCCGAATTAGATGTTGTTCAGCTTTCCACCCATCCATACCGATACTGTATGAGTCATAGAGAACATATTACACAGCAGCCTACATCGATACCG
CGGAAGCTATGAGCGACGGTCCCATGGGACTTAAACACTGCTGTCAACTGCGAAGCGTCAGCTACTGATGGACACGTAATTCGTTACCCGACTACCGGTA
GGTGTACACACGATACCGTTGGGCATCAAGCCATGTTCCAGTTGGTTGCAGTCTGCAGGCTTTCGTCAGTGGTGCCGCAGCAAATCAATGTTTGACTGGA
CAACGTTAGCTGATGCATCCATTACATAAAAAGTAAAAAACTTATTTAACATACCCTTGTTAAGCATAATAATAATTCACAGGAGATGGGAAGATCCACG
TTGTTTTAAACTCAGATCGAATAGCTCCGATTCAGTGTTGCTTACTGGCAGCTCATTCCCGAAAATCCTCGGCATCGACTTCCTGCAGCGATCATGCTTT
CTCCTCGTGCTATCCAGTCCGCTCGTGGCGTCGCCACAAAGGCCGCGACCGGCAAGTGGCTGGCCAGCGTCCCCATGGGCCCGGCTGACCCCATTCTCGG
TCTGACCGATCGCTTCAACAAGGTGCGAATAGAGTTCCCAAAAGATCCCAAAGTGATACATTGTCTGACTCTACTTAAAATTGTAGGACACGGACTCGCG
TAAGATCTCGCTGGGCGTTGGCGCCTACCGTGATGACGATGGTAAGCCGTTTGTGCTGCCGTCAGTGCTTGAAGCCGAGAAGCGCATCATGGCTGCCGGT
AAGAACAAGGAGTACGCCGGTATCGCCGGTATGAAGGACTTCGTGGACCTGTCGCTGGAGTTCGCTTACGGCGAGGACTGCGAGGCTCTGAAGGAGGGCC
GTATCACCGGTGTGCAGACTATCTCTGGTACGGGCGGTGTGCGTCTTGCTGGCGAGTTCTTTAACAAGTTCCTGGGCAAGAACACCCCCGTGTACCTTCC
CAACCCGACGT