Description :
From Genome Similarity Track
Location :
Scaffold_705:12100- 14398
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_705-abinit-gene-0.20Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_705-snap-gene-0.9M96 mating-specific protein family

Sequence
2298 bases(100 bases per row)
GGTGCTGGCGTACctGTGTATCCAGAATGGACAGACTCAACCGCTtcGTGGTCTCACGTTCTCTCGAGTCTTGTGTGGACCCTCAGTCCTTACATCAAAG
GaGGCATCTCAGATCGCAATGGTGGTTGCGCTTCAGAACGCGGTCTGGTGAGTGAATGACATTTGACAACGTtgAGTCGCCAGCGAAtgCGCTCGTCAAC
cTCCTTTAGTGACGTGCACAATTCCACTCCACACACCATCAAGCTCGCCCcGTcACTCGCACGTTGAAGAGCGTGACTCGGTCTCGCGACATCGTGCTGA
TCCTTACACAGACCCGACCCTCGTCTGCTGTTCACTCCACACGCTCCTCGcGCCCCTGggTGTCCGTCAGCATCCCACCGGGAgtcTCACAGAGCCATTT
TCATCTCTCCACTACAGTACAGCCCAACGCATGCCGCCAGCCCGCTACAGCAGTCcGTTCCCCCGACTGGAGCTCTCAGATGAGGAGAAGAAGCAGCTGC
AGCACACTGCCGACACCCTCGTCGATGAGGTCCACGAGATGCACGAGCAGCTGATCCGCAGAGATCGTGGCCGCCTGAGTGAGTCCGACTGGGACCAAGT
GCGCGAGCGTGAGGACGTGCGCGTGTTCCACCACCGACGCCCTGGCGCAGGCACCAGCAACATGAACATGCACTTGCTCCTTACGATCGGCACGGTGGTC
GGTACCCTGAACGAtGTCATGTACGGCGTGCTCAACCACACGACAGACGACATGCGCATCAAGACCATtACCTGGAtGACACATTGATCGACGGTGCCGT
GCTCGAGTCAATCACTGAGCGAACGCGCGAGCAACCGTTCGAATCACTCACAGTCAAATGGTTcGTGAAGGGACTGCCGCTGCTTGTGCGCACCGTATCC
AAGAACCGCGACTTCGTTTTGTCGAGGCAACAGGCGTCCGGATGATGCCGAATGGGGAGTCCATCGGCTACCATTTGATGCATTCAGTTGCGTTTAACAA
GCTTCCGCCATTGCCGCAGTACGAGCGGTCAGAAATGTCCTTCTGTACGCTGTGGAGACAAGTCACGCCGGACAAAGTCGAAgCCATGACACGCACTTAC
TGCCTGATTGAAGACACGCTGCTCATGTCTCCCATGATCAAGTCAATCGCCGATGCACTGGTCGCGTTGTGGAAGATTGTGCCATGCGCCCAAAAGAaGA
AGCTCACATGGCTCGTGCAAAACaGGAAGAACTTCGTCTCGGCGCAGAAGACTAACGGCTCCACGTGCGTCGTTTGCAGCGATCCCCTGAGCTCGTCTCG
TCGCGATACGAAGTATGCATGTGGAGTGTGTgcAAACATCACcTGCAAGCGATGCGTTGttaaGCACGACCTCGTCGCGATCGCGCCGAGCGGGCaGTTG
GTGGAGCAGAAGATGCGCTTCtGTTtgTCGTGCATGACCAAGGgCGCGCATCTGGACGCGGGTATTGTGGCGATGGATGCCGCCACGGGAGGCCAAGATA
GGACGGCGAGGACTCTGCTAAGCCACCAATTCAGCGACAGCAGTGGGGACTCGACAGTGCGCTCCCACAGGAAGTGGTCAATAGCGTGAAGCCGAAACCA
CGTAGGATGATTTAGTTAGCACTTGATAGAATCGCGCATTAACCTTAGTACAGACACGCAGACACGCATGATCTGCCAATAGTATTGTACAGTCCCGTTG
CCAATATCTTATTGGTGCGCCGAGCTAATTCTGGTGTTGAGCTAAGCTGACTCCTGCTAGTACTGTGACTGGGGACCAGTTTGAACTTCGGgTGCTGGCA
TCATGACACTTGACCTCGATGCGCTGCTCTTCCTGGACGAGCTCGTCGATGGCAGCGATGCAGACGCATCTGCAGTGCCATGCGCCTTCGCACCGCCCGC
CAGCGCGTCAGACACACTGACACTAGACGCGGtCTTTAGTGCCTCAACTGAGGAAGAGAGACCGTCGCCAGTCTCCTCCTCTGGTCTCGCCAGTGCGGAT
GGTGAGTCTGTAGCACCCCCAAGTGGCCGTGCGTCCAAGAGAAGGGCCCAGCGACCCAGGACATACGATCCGAATCGAGCTCGCAATGCCCGGCGCCATG
AGCTCGTCTACTTACGAGCCAAAGTGGCGGAGATGGAGACGCAGCTGAGTCAACTACAGGCCGCTACAACGAAAGCGTACACCACTGCAACTGAGGTGGT
GAGTGCAGTACCGAGGCGTCCCAGTCCATGGGAAAAGGTGGCGAGGAGGCAGAAGGAAGAGAGGCATCGAGCGGAGAGGGAACACGTACGGCTCAAGG