Description :
From Genome Similarity Track
Location :
Scaffold_495:1210- 4294
Transcript NameFunction/comments
Aphas_H257_19189putative retrotransposon protein

Sequence
3084 bases(100 bases per row)
TGGATCAAGCAAGTTAGTCGTGCCGCGGATGCTTTCAACATCGATGACGATGAGATCTGCGTGTCTTTCGCCATGTCGCACCTTACTGGTCGTGTGGATG
ATTTGGCCTAGGGCCTAACTTGTGAAGACGGCTTTGTGTTTGCCAATTTCGATGATTTCATCGAACAATTGAAGGCAGCGTTCCTGCCAGCGAACAGCGA
CTTCCGATACCTCGCGGAGTACCCTATCTTCCCGGCAAGGCAAGCGCTCTATTCGTGAGTGCGTCCACGATCTGCGCTTCCTTGCGTTCTGTGTCACCCA
GAAGTCTTTACTCTCCGAAGAGACTAAGGTGACTATTTTTATGAACGGCCTCAACGACTCAGCTGCGCACACGCAGCTTTTTCGGACATATCCTTCGACA
TTCGAAGATGCCGTCCGCACCGCGCTGGCCGAAGAGTTTTCGGTTCTCCAATCGCCCCGCGACCAAGACCCGCGACCCGCATGACATGGAGGTCTCTGCT
ATGACCTCACCCCCCACCGACCGTCGTTGCTTCAACTGCAACCGACCGGGACACTTCTCCCGCGAGTGTCGCCAACCACGCCGTGCGCAGACATCCGCTC
GTGGTACTGCCGCATCCCCTGCACCCCGCTTCGCGCATCCCGTTGTCGATCGCGCACGCGGCGGTCGCGAGTTTCCTCGCGGGCGGGGAAACGGGACTCC
TCAGTAGGCGCGAGGCATCCTGCTGAGGCTACAGAGTGCTTGCAGTTTGATCGTGGTGGCATAACACGATCAGCAGGCCCTGCCTCGGACACAGTGATTC
TGTGTCAAATCGGAAGACAACCTTCCCGCATGTTGTCCTTCCCCAGTCGTATCTCTGGGTACGACCGTTTGTTCCGCGTCCTCATCGACAGCGGTGTGTC
GGAAAATTATGCCCGACGCGCATCAATTCAGCTGAATCGTTCCATCTACCCACCCGGCGCGCATCGCCGCACTCCGTCGTGCGTGTAAAGATGGCTGATG
GCAAGGTTGTCACCTCGCCGAATGTCCTTGTCGACCTTCCCACGATGGTGGGAGATTTTGTCTCGACCGAACAATTCTACGTCATCGACCTCGATGACCG
CTGGGATTTGATCCTTGGCATGCGATGATTGGAGAAACACCAACCCTAAATCGATTGGCGATCCAAGACCATGCGCAAGATCGCATCCGTCCACCCTTCT
ACCGACCTAGGCGTGATGAGTAATGAACTCACTCCTTTGCCTGGTCTGGTGACGCCGTTAGTCACGCATCCCACCGCCTCGGCTACGAGGCTGGACGTAC
TTTCCGCCATGGTTGGCGATGCCGCCACGATTGGCGATGATATGGGAGCCGCCATGGTTGGCGATGCCGCCACGTTTGGCGATGATTCGAGAACCGCCAT
GAACGGCGATGGTCCGAATTCCACCCCCAGTGGACACTCGACGCGTGATGCTCACGCTTTTGTCCTCTCAGCCTGCGACCTGTCCGAGTTGCCGCTGACT
GCCGCTGAGATCACTCAGCTGCCAGAGATGAGCTATCTCTCTTTCGCCCGCGCGCTACGCGGGCACGACAACATCAGCATTGCTCTCATCACGGAGAGCC
AGGAGATAGACCTCCTGATTTCCTCGACAACCGACGATCCCGACGAGGAGGATGTGTCTCGTCCTTCCTCATCGGTATGGAAGGATTTGGAATCGAACCC
ATACTACGACTTGGTTCGTGAGTTCCAAGATATCTTCCCGGACAATGTTCCGGAATGCCTCCCCAAAGACAAAGGGGTATGGCATGGCATTGACTTGGTG
CCGGGCACCAAGTGGTGCGTCACTCGACAGTGGCCACTTCCACGCGACCAAGTCGCGTACATTGACGAGTTCTTTGCTGCACGCAAGCGAGCCGGTCATG
TGCGGGAGAGCAAGTATCCGCACTCCAGTCCCACTTTCTGTGTGAAGAAAGGCAACGGGAAATGGCGCATTGTTCACGCCTACAACAAGCTGAACTCGGC
CACAATCCCGGCGCAGACGCCGATCCCGCGCAAGGATGTCATCATTGACTCCATGGGACAGTCCACGATCTTCAGTACCATCGACCTTCGCGATGGGTTC
TACCAGATCCTGATGAACATCAGGGACATCGAGAAGACAGCCGTCTCTACACCCAGTGGAATGCTCTGGGAATGGCTGGTGATGCCCCAGGGGCTCAAGA
ACGCCCCTGCTACTTTCAATCGCGTCGTCACGGAGAAACTCCGTCCATTTCGCGAATTTGCTCCGTCGTATTTCGACGACGTCTACATCCACAGCCGCGC
CAGTTTGTCGCAATCCGACGCGGATGTCCACCGGTCACACCTACGTTTGGTGTTTGAGACACTGCGAGGCACCGGTCTATAAGCGAACCTGTCGAAGTGC
CTCGTCGGGATACACGAGATTTCTGTCCTCGGCGACTTCGTTGGCATCAACGGCTGCCGGGCGGACCCGGCCAAGGTTACCGTAATCAAAGCTTGTCCAA
CGCCAAGCTCAGTCCCCGAACTGCGTAGTTGGATGGGATTCGCCACCTATCTGCACAAGTACCCGGCGAATTTCGCCGACCTGGCATGCCCGATGAAACG
CTTACTTGGCAAGGACGTTCCTTGGGTATGGTCCCATGAGTGCCAAGTGGCCTTCGAGGCCGTCAAGGCGAGCCTCACCATGGCCCCAGTTCTGGCTCTG
CCAGACTTTTCCAGACCTTTCTTCGTGGTCTGCGACGCATCCATTCGCGCCATCGGTTGCTGCCTGATGCAGCGCGACGATTCGGGCAGGGATCGCCCGG
TATCGTTCCAATCCCGCCAGCTCCACAAGTCCGAGAAGAACTATCCCGTTCATGACTTGGAGCTTCTGGCGATGTACTACGCCCTCAAGAAGTTTCGAAT
TTACCTCCTGGGTTCGGAGGAATTCGTGGTCTTCACTGACCACGCATCGCTACGCACGGCCGTCCACTCACCGCATCTGTCCCAGCGCATGCAGCGCTGG
CTCTCCTTCTTTTCGGAATTCAACATGAAGGTTGAATACAAGCCTGGCCGCGACAACGTTGTCGCGGATGCTTTGTCCCGACTC