Description :
From Genome Similarity Track
Location :
Scaffold_2438:1210- 3917
Transcript NameFunction/comments
Phyta_totarag14492hypothetical protein

Sequence
2707 bases(100 bases per row)
tcATTAATCTAGCCTTAATTATTCTTGTgggacgcaagtataataaagcTAAGTTAAGtaacctacgcttcctcatacacgtgcgcacacgtgtaagctg
TAGTAGTGGGCTATGTAGGCTCAttacacctggtagcactttgTAGTCCGTCCAACGACCGACTAACTATGTTCGTATGGAGTCATACGAACGCAGGCAC
GAGAACCTTCCGATAGACGGAAGCCTAACGACACCTGCAACTCACATTGCACGTGTAGACTGCCCTCACCTGTCTGACCCAGAGTGGGGGGCGCTCCAAC
GACGGTCAACAGTCATTGGCGAAGCGGCGGTAGCGAcgatgctgcgcacgctATTACCGACAGAGCAACACCGTGTTGCTCTGGGCTATATCGTTAagga
gcagcgagatgctgctgctcctacgacggcggcgtcggTAACGACACCACGAGCGGTATCGTTAAAGCTCCACGTGAGCAATTACGTGGGGAAAGAGGGC
GAACCTCTTCTCCGTTGGCTAGTCGAAGTCGACACAGCCATCACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGCCNCG
AGGCGACCAAggtcgtcacgttcatgaaggGTTTGAAGGATGGTCCTGTGAAGACCTACCTCTTCCGAGAGTGCCCGAGTACTCTCGAGTCTGCGATCGC
ATTCGCAATACAGGAACAGTTTAGCCTGAAGCAGGCTAAACTGCATGTGAACGTGCCAAGGATGCCACGTCCGGTGGTAAAGACGGGAGGTCCGGAACCA
ATGGACCTCTCGAATGCGATGGCTGGGAATCACCCACCCCGTCGTGGGGCTGACGTGCGATGCTTCCGCTGCGGATGCATCGGTCATTTTGCGCGtgagt
gcacagcacctgTGCACGGGCAAAGAAGCTAATGTGGTAATGCCAGGTATCGCCGCGATCAATAAAAAAACGCGCGGGACCAGTAGGTGCGGGGCGCCCT
ACTGGTAAATCAGTCACGCGTGTCGACATCGGACACGAGTCAATGAAGACTGCAGCCCCTAGTGAGAGGCAATCTCACTGCAAAAAGCGAGATGACAAGC
CAAACCttgtcatcctggacgtgtcTTCGAAGAGAGCGAGCTCTCTTCGTGCTTTAGTAGACTCCGGTGCGTCGAACAACTTTGTTCGAGTGCAGAGTCT
GCCAAGCGTTGACCTCGAGGAGGTGCAAACCCCTCGAAGCATGttggaagtacgactggcAACAGGTGCCGTCGTGAAACCGAGAAGCGTGTCGTACGCG
TACGCTTCTCGTATCAACAAAAGAGATTTGTTGAGGACCTTGTCGTCTTAGACttagacgacaagttcgacttggtgctgggtACGCCGTGGCTTGCACG
GCATGACCCAAAGatggactggaagaagccTACAATCGAACGTTTCGGTTGCAACAGCGCGACAAAGAGTGATGGCCCTGTCAGCACAACACATGCACCG
CGAGGTGCATTCAACCTTCCAGTAGAGACAACGCTAAACGCTGCTGGCTCGACGAGTGGGGCGTGAATAGCGAAGCTCCGACGACTTCGGAAGTCGTCGG
AAGTGAATGTGTGTCGATTCTGGGAAACGACACAGAGAATCTGATTGGATCAGATTCGACAGAAAACTCCGCCGAAAGAcgtcgaggcgacgaagacgcg
tCGGCTCCGGGAGCTGACGCTGCGAGTAGTGCGGACGGTTGCAAACGCCTAGCACCAGAACAGCTTGTGAGCTCTCGTGCAGCCGGGCTTGGTGATGCGC
GCCCGCGGATAAAATCCGCCGGCGATAATAGCGCCAACCCGTCCAGCGCCCGGTCAAGCgggcgtggacgaggaaCATGCGGAACCGGGCTCCGCAAGAA
GGAACAACAGTGCAAGCTGAAAAAGCTGCACGAGTCTCGGTCCGGAACCGAGACGCTAAGCAAGATGTCTACCGGGCAGACATCAGTTCCGACGTCGAGC
GTGGCGACATTGAATGTCTTGACGCACACCTGTACTGGGCTTCAGTACAGGAGTATTACTCTTGATAGTCCTCCGACGAGTGCGTCGGAGTTGACGTCGC
TTCCAGtcatgagctggaagcgctttGCACGCGACTTGCACGATGGGcgcatcgagcagatctGCATCCTTTCAGACAGCGAaaggttgaagtgcgagGC
GGAAGGGTTGAAGCAACTCGTCGCTGACAGCATCACTGAGAGTGAGGACACTCTCAGCGCCAAGGCGGACAAGGAGCGCTTCGAAGAGCAGAGTTGGGAC
TCGCTCAAGTCAAGTCCCTATTACGANGCACGAAGTACTGTGTcacgcggcagtggccactgccgcgagAGCAAGTGAAGGCGATCGACGACTTATTCGA
GAGTCGTCGCAAGGCAGGTCAAGTGCGGGAATCAAAGTCCCCGAACAGTGCACCGATGTTCTGTGTTAAGAAACCACAGGGCGGCTGGCACATCTTTCAT
GCGTACAACAAGCAGAACGATGCGACGATACTGGCACAGACACCGATACCACGAAAAGATGTGATCATCGAATTGATGGTGCTGAGCACCATCTATAATG
CTCTCGATCTGAGAGACGGGCTGTATCATAGCTTGATGTGTGAGAGCGACACCCCTCTCACGACGGTAAGCACTCCAAGCGGTATGCTTTGGGAGTGGCT
CGTCATG