Description :
From Genome Similarity Track
Location :
Scaffold_529:1210- 3312
Sequence
2102 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTAGGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAACATCTTT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCAAGTTTAGGATATTACATTTAGAGGAAGTCAGAAACATAAA
ACACAAATAGCCGTTCTCATTTTAACCCAAAACATTATTTGGATCGTTTATTTTTTTTAGATTAATCTATACTCGGAGGCCCGAGTATAACTAACTCTAC
GTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGGTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCG
TCCAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGAATACGGAGGTGTCCATGGAGAGATCCACTATGCC
TGCAACTCACATTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGGTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCT
ACGATGCTGCGTACGCTAACGCTGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTACTTCGTCTACCACGGTGTCGT
CGGGGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACAC
TGCCATTGCGGCTCGACGCATCGTCAACCCGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCTAGAAGTTGGGCGTATGGACGCCGA
CTCTCGGAACCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACAAGCGTTTGAGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTGAATGTGAACTCGATGAGAGCA
AG