Description :
From Genome Similarity Track
Location :
Scaffold_1796:121- 2419
Transcript NameFunction/comments
Phyag_g11495hypothetical protein PHYSODRAFT_338429

Sequence
2298 bases(100 bases per row)
CCCCTTAGGCCAGGGACCAGTGAACTGCCgttcactaggagtttgtatactcctgcacacttcctctgtgcaaggtgctgtgtgacccccgtcacacTGG
TGGCAATAACTATCGAGTTGCACacatgtcgaagaagaaactggagCGGGAGGGACGACTTCCAACGAGTATTCGGTGCACATGTGCAAATGAATCGTTT
ATGCACATGATGGGAGGTAGCTAATACTTAAACCAAATGAAAGTGCCTTACTAGCTTTCCGGAACAGACAAAAGAGTGGTACCTTACTATGATAACGGAA
CGGAGTCGTACACCCAAGAGCCGAGTCCTAAGGCTTTGCAGATTTAGTCCGAACGTCCGGAGAACTTTTGTCAATCCATGCCGTCTGCCTAGGCGAGTGA
CTGTCACTGTGAGATCGCCTGGGTATGTGGAGCTGGGGTTTGGATTTGACAGCAACCCTCTCGGACGCGggaacaggccccgtcgacgagaagcgacagg
cttggcggggtgaagactgtaacacNTGTCCCCTTAGGGATTAGTCCGACCCGTCGCCCCCACGCTAACGCCTGGTCGTTGACGTGGCTCGGATAGGTCC
CTTTGGAGATGGCGGTCCTTAATACCGGCAATCCTGCTTCAGGCAACGCTTCCTCCGCTTCCGCTGCGaacgctgctccacctgaCGCGGTGGTGGTTTC
ATCGTCGCTTGGTTCACCACCTGGACCTTCCATGATccgctcgtcttcatcggaAAACGCTATGTTGCGCCCTGTACGGTCGAAGACGTCTGTTTCGGGT
ACATCTGTGGCCGTAGAGCCCTCAATGTTTGAAGACGGCTTaaatgaagatgaagagcaccTGTGGGACGCCATGCTTCGCGGAAGCTCGCTCCCTGAGG
TCGATTTGCTCAGTCCTGTCATCTCGTCGCCCGTGAGCCCTCGCGCGTTGCCTGCACGCTCAGTCGCTTCCTCGGTCGAGAGTTTCATCCCGACGCGCCT
CCAAGAGTTGATGTTCGAGCTGGAGTTCGAGTTGTACTGGGCCCTCCCATTACATAAGTAGGTAGATATCTTTCATTTATTACATAAGTAGGCATGGTGC
CTCACAGTtagtgtgtggcacacagtCATTagcggattggttgaaatgaacattcatttcagccaatcagacaTTGACATGTATATGAGTGGTTCACATG
AGGCCTAGGGCTACCGCCCTGGCTCTAAATGAAAATAGAGTTAAATTTGCTTCGGACTTAACACTTGGCTTTACTATTGTGAGCTTCCTCTACACTACGT
GTAAGCTAGTAACGGTAAATACTTGGCCCGTTACACGAGTGTACTGACGACGAAGCAACCGAAGATCAGGATGCTGCTGTTACATCTGCTGTGGAGCCTG
ATGATGATGTTCCTGGTGCGGGACTTTTtgacgacagtgacgatgaagaaactATGCGGCCAGGGCTCTCTCGGCTACGTCGTGGTGATGAGACGTCGTT
TTGGCATCCACCGCTTCATGATGCTCCTGTGAAACACTCAACGACAGGGCACCGGAATCACTACAAGAAGGACGCGGATTGGGACTACGATGTCGTGGTA
CCTATTGTGTGCTTGCTGGAGGTTCATGGCGAGGTCCCGCATCGCTGTTACTTGGCTCAATGGAAGGGTCGTCCACTCGAGATGAGTTGGATTTGGATGG
AGCAACTCGACAAACCGTCGACGCGTCCCATGATGCAGCAAGTCGATGCGTGGAAGGCTTCTGGTACGGAGGAAACTTTCATGGACTGGAATCGTGAACG
TGATAGTGCGTCTGCGGTAGGAACTTGCTTCATGGACGCTCTCCGGTCCGCGCTGTACTACCTTGGTGCACATGATCTCGTTACAATGGCGATGTGGGAT
GCCTTCGAAGACACACGACCTCCAGCTATTCAGTACGGCGTTACGCGTGAAGACGTGTCCGAGTTCTTcaagcttctccagcgtcaaaGTGTTCCTTTGA
ATTACGACCATCTGCACAAGAACATCCTCGACACGTCAGCTGCCAATATCAAGACTCTGCTTGCCTTTTGTGGAGAGCTTGCTCCATGCGCTTACGTCGT
CAGCGCAGGTCAGGACGGTCTTGGACATTGCTTTGTCGTGATTTCATGTGGACCTGGCAAacgtcttcttgctctggACCATTACGATGACAAAAAGGAT
CCCCCGATGGAAGTTCTTCCTTTGAGCCACCAACAATGGATTGATCACGTGAAATGGATCGCTCGGGTGGAGCTGAAGCCTGGATACAAGTGCCGCCA