Description :
From Genome Similarity Track
Location :
Scaffold_5:1209715- 1212561
Transcript NameFunction/comments
Physo_511090Hypothetical protein
Physo_509358Hypothetical protein

Sequence
2846 bases(100 bases per row)
CGAGTTCATCGAGATGGCGGAGAGCACGGTGTCGTCCTCCTGGAAGTCGAAGAAGCCGTGCACGTAGCACTCGACGCTGTTGGGCGCGCGTTGGCGATAC
AATGCACAGACGGACAAGTTGCCTCGCTCCACGTCGGCGTTCTGAAAGGGAGGCAATTGCGGAAACCCGACGGAGTGTGCGATGTGGTAGCCGATGGACT
CGCCCTCGGTCGTGATCGCAACACCCGATGCCTCGACGCAAATGTAGTCGCGGTGTTCAGGCACGGAATACAGTCGCCACGCCACGTTCACGTGCTGATA
CGGGTCCTCCACCGTCGGACGCACCACCTCGTGCAGCACCTTGGCGTCTACGATGCCATCCTGCACGAACTTGGACTTGACTTTGATGTCCTCGTCGCAA
GAAGCTGAGACCGCGTACATAACGTCGTTCAGCGTGCCTTTAATGGTGCCGAACAGCAGCAACGAGGGCACCGTCGGTTCAAGGGCATCGGGGTCTTTGC
TCTTCTTGCTGCGTTGAGTGTACACCCGGATGGAGTCTTTGCGGCGCAGCTCGCGCCATTCGCGAGGCGTCTTGCCAGTCTTGCGAACCCGCTCCGAGAC
GTGGAGGTACTCGTCGATGTTGCTCAGCACGAAGTTCTCCGCCAAGTTCTGGAGCTCGATCTCCTCAGTGTCGTTGAGTTTCAAGGGTGGCAAGGCGTCG
ACGAGTGAGTGGACGGACTTCATGCTCTGCTCTTCGTCCGACGGAATCGCAAATGATCCCAGTCGCAGCAGCAGCAGGTTCGTCGACCAGAACAAGTCGG
TGGGATATAAGTCCAGCTTGAGGCGTTCGGCGCGAGGCCTTCTCCTTAGGCCAATCGTCGACGCTAGCGCCGGCAAAGTCCAGAACGCGTGATGGCTCCG
ACCAATGGAGCGCCACGCGTGACAAGCGAGCTGCTCATCAGTCGAGAGCAGCAGGTGCTCGAGCCAAGTTGAAGCGAGAAGATCGCTGAGCTTTTTGACA
CGGACGGACGGAGTCACGTGCATTCCTGTTTCTCTTTGGGGCTATGGTACTAGTGCTGGACTACTCACTCACACGACGACGGCCAGCAAACAAATTGTCC
TCGAGGTTGCGTTGCCTCCGAGGGGTTCAGTTCATACAGCTTGTAGTGCGCAGGTCTCGTCAATGTGCGGCGTGTCTTCGTCGTCCTGTGGCTGCCGCTC
GTGCAGCTCTCGGATCTCGTCCTGGGCGATGGCCAGCGCGTCGCTCTTGGCCACTTGGCAAACGCACGCGGCGCAGAACGTGCGCTTCTTGTCCAGCACT
GTGCGACGGTCGGGCGCCAGCACACACACGAGCTTCTTGACGCTGCAGCTGGAGCACACGCCGCGCTGGCAGATCTTGCACGTCCGACGCAGCGAGAAGC
CCAAGCTGCGTCTGCAGACAGCGCACCCACTGCCACTACCAGCTTCACTCTTGTCGATTTGCTGCTGCGCGGTCTCCTCTACCGGCTCGATGACCATGGG
CCCGTTGACTGGGAGGCCCGAGTTCTTGCGCAAGCGCCACACGAGCTTCTTCATCTCTGCGCAGTCGACGTACCGTGAGACGCTGAGCCATTGCGTGGCC
ACCGCGTTGATCGACAGGCTGTTCATGAGCTCGTTGCTGTCGCTGCGGAAGTCGTAGAAGCCGCGCGCGTAGCACTCGACGAGCTCGGGCGCCTTTTGGC
GGAACAGGCAGCACACCGACATGTTGGCGCGCTCGACGCCGAACTTGTCGAAGCTCGGGATCTGCGAGAACGCCACCGAGTGCGAGATGCTGAAGCCGAT
TTGCTCGCCCTTGCTGCTCGTGGCAAAGCCCGTGGCGTCCACGCACACGAAGTCGCGCGCGTTGTTGTGCAGGCGCCACTTGACGCCGACGTGTCGGAAC
GGCTGCTCCTCGCTCGGAGCCACGACGGACTGCACCACTTTGCTCTCGAGCACGCCGTCCTGCAGACACTTGGACGTGAGCTTCATCTGCTCGTCGGTCG
CGGCCGCCGCCACGAACATGACGTCCTCGAGCTTGCCCACGACCGCGCCGAGCAGCAGAAGCGACGGGATGCAGGGCAGCGCGGGGCCGGATGCAGTAGA
GTGCGTCGCCGACCGCTCCTTGTACACGCGGATGCCGTCCTTGCGGCGCAGCTCCTTCCATTGGTGGGCGTCCGCGTGGCCGTCCGCCGTCACCTGCAGC
GCGTTGAAGCTCTCCATGTTGTGGACCACCAGCGTGTCGGTCAGCTCTCGGAGCGACGTCACGTCCGACTCGCCCAGCTGCAGCTGCGGCACGTAGGCCG
CCAAGTCCTGCGATCGCATTGCGATGGAGTGAATACCTAGATGTTCTTGCGCTCTCGTGTCCAATCCCGGAATGAAGCCCTCTGGTAGCGGAGACCGTCA
TTGCGCGCGTCCCGCCACGCACTTCAAGCTCCTCGAGCCATCGTAAAAGTTCGAAATCAGAAAGAGTAATTTTTGGAAAGGCAAAAGTACACTATCTATC
AGATTTACACGTTTTGTTGACACTGTAGTATACTAAGATCGGACGATCTGTTGTGTTTTATGAACACTCTTATGCATACTTTCATGAAAGTTTTTCGACC
TGAATTATGTCCCGATGACAGGTCATGTCTTAGCGACCTGAACGGCATCGCTCTTCACTCTCCACGCGTTTAGACTAGTCTGGTAGTCTGAGCTGGTCGT
GGAATCCGGGCGCCTTAACCCAGTCGCCCCCCCATGTAGTGCATCAAAACTTTTGATTCAAAAGTCGCGGCCAGATATCGGATGATCCGAGCCCCTTGGC
GTCGTTTCAATTTTCGAACGCGAACTTGAACAGGAACGACTCACTT