Description :
From Genome Similarity Track
Location :
Scaffold_42:120951- 122822
Transcript NameFunction/comments
g17345.t1hypothetical protein

Sequence
1871 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAA
GTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTTCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAAC
CACCGGGCGGGTGGCGCATCATTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTC
GATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACTGCGGTAAGCACT
CCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGC
GCGACTTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAACGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTT
GCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAAC
GGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACT
TGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGC
CTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCG
ATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTAC
ATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTT
GCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGG
TTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAAGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTC
GTCCTTGTTGGATGACGTGAAGGCCGCATACGCGCATGACGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAG
CTGGCCAAACACCTTCGTGCCCGTGTACACTGCTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGC
CGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAATACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCG
TGACTTCTACTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTG