Description :
From Genome Similarity Track
Location :
Scaffold_65:120938- 123208
Transcript NameFunction/comments
Hyaar_Emoy2807521AlNc14C393G11300
Hyaar_Emoy2807522HD repeat domain-containing protein

Sequence
2270 bases(100 bases per row)
CGATGCCTTTTGGTGCCATACCCGCAACGGAATGACGCCCGAAGACTTTCCAGATAGCCGCAGCATCGTGGCAGCACAGGAAGGAATTGTGGGGATGAGT
CGAATCGAGACCGAGATCCGCAATCTCCACGAATCAGCGATGGCGTTCTTCTACTTAGAATCCGCGTATGACCACTGGAAGTTTGTAAGACAAATGGTTC
GTTATGCGGACAAAAGGAAGCACAATTCGCGTGTGCTTGCGCTGTCCATTTCACCGGCGTGTCCATACAACATGTACCTGATTCCGCCAGGGGCATCAAT
AAACAGCGAGCACAATTCATACTGGCCGGAAAAGGCGCTACCACGCACTGGAATTGATCGTAAGGGTGTGGTTGGATTTTTGACAAAGAAGAAAATTAGA
TGAGTCATGCTGCATTCCACGGCAGGAGAGGAATCGACCAAATCTAAGGTTGGCTTTAGAAGCACAACTTCGAACTGCCCTGCACGGCAGGAGAGGAATC
GACCAAATCTAAGGCTGGCTTTAGAAGCACAACTTCGAACTCTCATGGACGATACGTGAAGAGCGAGTTGAAGCAAATTGCGCTGCGGCTTTTTGCTCTC
ATCGTCAATCGATCTTGGTCACGCATCGTGTAGTGTTGCAATATGCTGCACTCAGCAATTCAGCATGGATCACTGTGGGTTACTCGGTGTTTTGTCGTTT
GAACATTCCTGCTGAGGCAGGCGTTAAAAGTCCCCACTCGTTCTGCCATCGCCGTAAGCAATTGAGTCTATTAGCACGTCTCACATCCGGCGTACTTCAG
TTCTGGCAGCGGGAACGGACTTACAAACCTTTTGACTACGTGCTAGAACGCGATTGCGAGTGGGTGAGCTACATTGAGGTACTGATCCTGCCTCTGAAGG
AACAGAACGCAAATAGAAGTTATGATGTGAGCAGGTATCGTGCTATGTTCTTGGCAAAGTAAGCGGGGTATACGTAATGCGAGCACTGACGCAAAGTACA
ATGTTAAGGACCGTATCGTTGTGCGGAAAGTCTACCATGAGCGGCTCGTGAAAAGTGGGAAAAGCGAGTGATCTACCGCCAATATGTTTCGTGCACTCTC
CAGTAGTAGGTCGCTCCGTGGAATCATGTCCGCTCACATCACCAGTTCCTCAATTGTCCGTGACGTGTCAAAGTTCAGTGAAGTGGTGTCACGATTGCAG
CGTAAGCAACGGTATTTGGGGCTTTTTCGCTAACCGAACTTGTGCAGCGGGGTATGACTAAGTGATATGCTTGTGAGCTCCTTTCCTCCGAAGCGAGTCG
CAGTGCAATACAAACGTGATACAAGTGCTTTAAAGGTGTCATTTGACGCATGAGATCGAGTTTGTGAGCCAACATGCAGGTAGCACGGCTAGCCATTCTG
TCACAGTGGTCTGCGAGAAGTTCATCCAGTTGCACACGATTGGATGTGTCTCCCTGCTGATGGACATAAGCTGAGTCGACTATCGATGCCGATATGATAC
AGAGACACCGGTTACAGCGCTCATCTTTTTTGAGAGTAGCCCCCAAGCTCTCCCAACGACACTCTTCTCGCCACCACTACCTGGATGGTCGAGTTGGATA
GCACGGGCTGCTAACAACTTGAAGTGTCGAGTCGGGTGGCACGGACTGCTAACAGCATTTTTGTGCTGTCTGAAGGTGTTCGCTGGTAGGGCCGCAGTCC
ACATAGTGCATTTGATCAGGGTTTGTGCTACTCGATTCAACAACTGTCCAGTGTCCAAGCACCAACAATACAAGGATGTGACATTGAGTCCCATCTACGA
CGCCAGCAGCTTCTGACAGATTCAAAAACAGTCCAAGCGAACAGCTAAACTCGAGCCAGTACAGCTTCCGGTGACTTCTGCTTCTTGCTTCTCCCGCATT
CTCATTCTGCCTGTTGGGTCAGTTGAGCTTTACCGGACTACAATTTCTTGTATCCGATGTGCTTTCATACGCTGCATTTGCTGTAAAAGTAGCAGTTCTC
CTCCTGAGTAAGTAAAATGCAGTTAAAAGCACCTAGGCTCGAACTTTACGTCCGTCTTGAGCGTCCTGTACTCGAGCCACTAATGAGGGGCCGTTGACTG
GCTGAGCTGCAGCTCCTACCTTTAGCCTTACTAATGAGGTGAATCAGTGAACACTCGAGTCCTAGCCAAGTCGCCTAGTACACACCTCATGGCTCCATCT
CAGCTGGTGCAGCGTACCGCAGCGTTTGTCAAGCAGCAGCTCAAGCCCAACGACGCGTCGCACGATTGGG