Description :
From Genome Similarity Track
Location :
Scaffold_705:12093- 17004
Transcript NameFunction/comments
g15971.t1hypothetical protein

Sequence
4911 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCACATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCC
CATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAA
GTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTCTGTAGTCCG
TCCAACGACCGACTAAGAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCT
GCAACGCATGTTGCGCGTGCAGACTGCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGAGAAGCGGCGGTAGCAAC
GATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTACGGTGTCGCCA
TCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCAAGGTCGACACTG
CCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAAGAGTTGGGCGTACGGACGCCGACT
CACAGATCCTACGTGCTTTAGCACGTACGAAGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTC
CTCGATCTGCAACAGGGCAAGCATAACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAA
AGGTCGTCACGTTCATGACGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAAT
GCAAGAAGAATTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATG
GACCTCTCGAGTGCGACCGCTGCTGGGAACCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGCAACATCGGTCACTACGCTCGCGAGT
GCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCC
TGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAACAAGATGACAAG
CCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGATCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCC
TTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGGAGTTCGTCGA
CGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACG
ATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAAAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAG
CGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATC
CGATTCGAGAGGGACTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGA
GGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCG
GGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGG
GCCTGGCCAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGCGAACTGCGCAAGTCTCGGTCAGGGACCGAGACGCTATAAGTAGTGTCTGCCGGG
CTGACACAGGAGTTGGAGACAACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAACATGAGGCTGGAGAATCCTCCGA
CGTTAGCGTCGGAGTTGACGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCAGA
CGTCGAGAGGGTGACGTGTGAAGTAGAAGAGCTGAATCAGCTCACCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGAAGAACTTCGACGAG
CAAGGCTGGGACTCGCTCAAGGCGAACCCCTTTTACAAGGTCTTGCGTACGTACTCCCGGACGACATTCCTGTGGAGTTACCGCAGGACAAGGGTGTTCA
GCACGAGATTGATCTCGTGCCAGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGT
CGTCGCAATGCAGGGCAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGT
ACAACAAGCTGAACGATGCGACGGTACCGGCACACACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCT
GGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTTGTG
ATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGATGATG
TGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGCGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTA
TGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTTGTCTCGTGGGGAAGAACGGCGTACGACCTGACCCAGGAAAGGTCAG
AGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGAC
AAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTG
AGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACACGATCACGAAGGTCGTG
ATCGTGTGGTTTACTACCTATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAA
GTTTCGAGTGTATCTACTTAGAAGTAGACCATTCGGACCACGCATCGTACATAACCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTT
CCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCACGCAGTTGGCG
TCGTCAGGACGACTACACCCTCGTCGTCCTTGGTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTACTTCTCCAC
ACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGATATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGAC
GACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCACAAGGTTGCGTACGAGTACCACGATGCCCCGACATCGGAACATCCTGGCTGTT
AGAAGACGTACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAA
GCCTGCGCCCACCTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCTATGGACTTTGTTTTTGGTCTTCCGCAAGAC
AACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAACAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCAT
GTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGCCATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTT
TACACTTCTTG