Description :
From Genome Similarity Track
Location :
Scaffold_110:120913- 124968
Transcript NameFunction/comments
Hyaar_Emoy2809820reverse transcriptase-RNase H-integrase

Sequence
4055 bases(100 bases per row)
TATTACCACCATGGCGGCGAGTTGTTCGCTGAAGATGTAGATCAACATATGGCAGTTCTGCCCGAAGTTGTCACGCCCATGCAAGAAATAACGATTGACA
ATATCAAAGTGAGCGATCCAGGATTCCCAAGAACTGAGGATCAAGAGAAGTTGCGACAAATTATTTGGAGTAGTCGCCATTTGCCGATTGGAAAAGGCAA
TGCCCTAACACATGTTGCGGGTGGGGCAGTTTGTGATATAGATGTGGGTGGGGCCAACCCGGTCGCGCAGAGGGTCAGGCCTATGGCTTCCAAATTTTGA
GAGAAACTCGCCGAACAAATAAAAGGATAAATGTCGGCCAAGATCATCCGACCATCTACATCACCGTGGGCGTCTCCTATAGTGGTGATCATCAAGAAAA
ACGGAGAAGTCATAAGTCTGTGTGTATTTATTAGAGGAAGGTGAACCAGCTGACTAGATTGATGGTATAACTAATGCCTCTGATCAGTGAACTATTGCAG
GAAATGGATAGAGACATGTGGTTCTGTTCCCTGGACATGGCGAGTGGATTTTGGGTGGTGGAAAGGACTGAACGGGCAAGGGCGATTTCCGCTTTTGTCA
CATCATCAGGGTAGTTTGAGTGGGTACGAATTCCTTTCGGGTTGAAAAACTCTCCACCAATTTTACCAATGATTGAGTGATATCGCTCTGTATGGATACT
TGAAAATCAGCGCAAGATTTGAATCAATCACGGCCAAATCACCGAAGTTGATCGATATCTTCACCGATGGTGAGCCAGACACTAATCCGAAACCATCGGG
GTTGGGTCGAAGATCCTATATCGATGACATATTGATACCAGCTACGTCGTGGAAATCTTTATGTGAGAAAGTGGAGAGATTATTGGAGGCGCGCGATAAG
TGTAATTTGTCGATCAGTTTGGCCGAATGTTTCTGGGGAGTCGCAAGGTGGAATACCTAGGACAATCAAATCTCGCTCGCAGGTTTACAATCTTATATCC
GACAGATTTGGGATCGTTGGTGAACATCCAGTTCCCGAGGACTCTACGATCGATGCAGTCATTTTAGGGAAGTCTCAACTACTACAGTCGATCGGAACTC
AATTGCAGAAGACGATCGCGATATGTACCCACAACCGGGAATCGATATCGATCGTTATCCAATTGTAGGGGGCGGTCGCGATCTGTACCCGAAATTGGAT
ATCGATGTCGATCAGTACTCAATTGAAGGGTGCAATCGCGTTCCCGAGGTCAGGAATCGTCGGGAGAAAGCAATGATCGCATTCACGTTGCTAAAGGCTA
AGATATCCACAACATCGATCTTGAAGCATTTCGACCCCGATCGATCGCCTGTGGTCGTAGTGTATGCTAGTAAGTAGGCTGTATCAGCGGCTTTGCTTCA
CGAATATGACGGAGTATATTGGCTTGTCACTTTCTTGAGTCGTACGCTAAAGCCTAGCGAGGTCAATTACGGGATGGTGGAGAACGATGGGTTAGCTCTT
CTGCAGATGCTAGATGTCTGTTATACTATGCTAGTATACCGCGAGATTACAGTGCGTACACGATATTCGACACTGGCATGGCTGTTACAATCTTCAGGTC
CTAACGTAGGATTGGGAAGATGGGCTGCTTTACTACCAAACCGGACGTTGGAGATTCGAAGATCTGAGAAAAGAGAAGATGAAATTCTCGGCATACTTGC
TGCGAGTATAACGCCCCATGAAGAAGTGGATGAAGTATTGATTGCGATTGCCCCGTGGAAGCAGCCAAGACAGACGATAAGTATACCACCACTCACATTG
GGAGTGAATGAAAAGAAAGGGCGGAGAATCCAGCGCGATTATATGGTAATTGCCGGAGTTGACGATTGTAGCGGCTGCTTCCGGGTTTACCCCTGATCTG
ACCGTGAATTAAGCAGCATACCGAGGTTTGCACCTCAGTTTCGATTTGCTTACCGGTCAGGCCATGGGGCGGGTGATTATCTGCGGAGATTCAAATTTAG
TGATCCACCAAATGCGAGAAGAAATCGACTGTAAGGCACCAGGACTGCAATTGCTGAGGGGAAGAGCGATGGAGAAATTCTAATCGTGTCCAGACCATGA
ATTCCTGCGTATGAAGCGTGATTGGAATCAGAGTGCGGGTCGGCTGGTGAGTAAATATATACGGCAAGAGAAAGAAACAATTGTGATTTCGGATCAGGAA
CGTCAGGATTTGATCAATCCTAACCGGTTAAATTCAATTGCTATTACCAAAACGAGTCCATCATGCAGTCAAGGTGGCGGCTAGCACTTGATCGGCCCTA
AGAAGGCGCTGCCAGCCCAGGATTTTACAGGAAGATGTCGTGCAGCAGATACAGATCGATCGCATTAAGCAAGCACAGACGAAGCAAATTGGATATCCAG
TCTGAAGACATATCTGGTTGGAGATGAAGCTAGATTATCGGCGGCTGAAGCCAAAGGCTGCGCCATGATCGCACCAGATTATTATGTAGACCAAATTGGA
TTGTTTTTTTCTGTAAGAGATCGGCCACTGAATCGAAGGCCGTACTGAACTGGCTTGTTCGGTGGTCCTAGAGCAGTTACAGCGAATTTTCTTGCACCAC
TATCACACAAGTTTGTAGAGTGGTCATTAAGGAAATTGGCCGCACTTATCAATGGATCAGGGCGAATTTTCACTAGCGCGGGTTGTACAGAAGTGTGTAG
CGGTATGTGGAAGAGTTTGTGGATTATAAAGCAGGAAAAGGAGGACCAGGTGATCGGGGCGGACCACCTGGAAATTTGAAATCGACGTACCCTTTCCAGA
TTATTGCTGTGGCTCACATCCGTTCGCTGCCACGATCGTTTGAAGGGAGCACTGAGATGTTATTGTGGGTCGATTTATTTTCGGGGTATGTGATCGCGAA
AGCAAGCTCGTCTAGATCTGCACAGACGATCGCAAAGAACTACGAGGTAGCGTGTTCAGACGATTCGGCGTGAGTGAGGCGATGCGCCGAGATCGCGAAT
CGGCATTTATGTCAGATTTCGTCCGAGCTCTCAATCGGATTGCGGGACAAAAACAACCGGCCCCCATGACATTTAGACCGCAAGCGAATGGTACGGCGGA
ATGCATGATGCAGACGCTGACCCGATCGATCAAGATGTAAGTCATGGGTGAAAATCATAAAGGCTGGGACGAATACGCAGAGCGATTGACCTATGCGATC
AACACCGCTCATGATCGAATTTGTGGAGATACACCGTTTACCAGATTCTGGGCTGGAACATAAGATCAAATTTGGAGGCAACCTTGCCGTTAAGAAGCAC
CAAACCCCGGGGTCGAGATGCACGAAGATGGAGATATGGAATTCAATGCTAATATCAGCGTGCGCGGGCGGTACTATATGACCGATTGGAGGTTGCTATC
AAAGGTCGAGCCGATCGACCTAATGAAGATCGAAATGTATTGGATGTCTAACGCGGGTCACGAGTTTGGCTATACCTGGTTCGTGCCAAGGAAGGATACG
CTCGGAAGCTATCTCATATGTGGCATGGACCTTTTCGGGTGGACGAGAAGTGCGGCGATCATGCCTTAAGGTTGGAAATCGCGGGTAAGCCGTACCGGTT
TTACCCAATGGTTCACGTTTCTGAGCTGAAGCTAGTTCGTGTGTTCCCAGAACGCCCTACGAGTAGATTGAATGTGGATGAGGCCAGTTGCTTCGATTTT
GACGATGCCCTACTGCCTGAAGATAGCTGGGAGGGTGATATGGACGCCGACAAGTTCGAAGTGGATAAGATTATCGATGTGCGATCGGAGGAAGACGAGA
TATGGCCGATTACACAAGTAGTACCTGGTACAATGGAAGAAGTACAGCTATCCAACCTGGATCGCCGAAGCTGATCTAAATCGTGAAGCTATGTTGCAAG
AATTCGATCGCGATCGGGTGAGTAGGAACAATTTTGAGGTGATGCAATCTCATGAATAAGAAGCCAGAGATTAGCGACGAGCAGAGAGCTTAAGAGGGTG
TGTCTATGCAGGGAAGGCGCATAAACGGGGATGAGAGTTATGGGTGAAAGGAGGT