Description :
From Genome Similarity Track
Location :
Scaffold_829:1209- 5065
Sequence
3856 bases(100 bases per row)
CAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCACAATGCCAGAGTTGCCTTCCGAATCTTTCGGTAGGCCAACCACAAAAGTCCATACTCATGGACTACCACCACCCCAGTTGTTCCGGCAGACTAGC
CAGCGGCGCCGCCGCATGTTCTGAGGATTTAACCCATTGACACGTTTCACACGTACGCACATAGTTGCTCACCCACTTGTATAGTTCGGGCCACTAATAA
GCCTGGCTCACTGAGCTATAGGTCTTCTCACGACTGAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGAGTATTCGATACTTCAACCCCTCATCAT
GAGGGACAGCGATACGAGGGTTATCCTCAATATCTGTGCGATAGCACAACAGGCCATTACCGATAGGGTTTCGATGTAGCCTCGCACGTAAACGTGGCGA
CAATTCTATGTCCGAGTCTTTAAACGCCTCGCTTCCAAGCGCACGTAGCAAAGCTACATATTGCTCATCCTTGGTATAAGCCGCACGGATTAAGTCAGTG
ACTGAAGATGACAGCTTAGTGACGTGAGCAAGCTCATCGTCAGTTCAGCGCGGTAGCGCGTCAGCCAAAGCATTTTGCTTACCTGGCTTATACTTCAATT
CGAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGCCATTCTATGAGAGAGATGCGGCGACTGTGTCGCAGTGCGCAATGATGCATGATCTGTATAGAT
CACAAATGGCTTTAAGCCAAGCAGATGTTCTCTGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTTTCATGAACTGGATAGTTCTTTTCAGCA
GCTTTGAGCTGTCGAGATTCGAATGTAATGACGCGTTCGCGTCCATCGACATCTGTTTGTAACAGAGCACTGCCTATGGCAAAGTTAGACAGACGACATT
GAAAGGCCGATCAGGATCGGGCGAAGCCAGTATTGGCGCATGAAGGAGACTTTCCTGAACTGCTTGAAAAGCATCATGTTTGGTGTTACCCCAACACCAA
TCCACATCCTTCTTAAGGAGATTGGATAATGGCCGAGCCATATCTGCGTAATTCGCACTATACTTATGCAAGTAATCGGCAAGGCCAAGCCACTTACGTA
GGTCTTTTTGGTTCTTTGGAACCGGCCAATCGACTATGGCCCTTACCTTAGCGGGGTCCGCTCGAAGGCCTCGCTTCCCAATGAAGCACCCCAGAAAGGG
AATCTCTTCTGCTACAAAGATGCACTAGATGCATTTTCATACAATTTATTCGTGCGCATGCACTCGAGCACCACTCGTAAATGATCAATGTGATTATCCA
CATCAGACCGACCGTTCGTTGCACGACTATGGACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTTGCGTCACCAGACG
ATTAAAAGTATCCGGAGCATTTGACAGCCCTTGTGGCATAACGAGCCACTCCCAGA